Informations

Confusion concernant le raisin sans pépins et le processus normal de germination

Confusion concernant le raisin sans pépins et le processus normal de germination



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

En général, le raisin sans pépins contient-il par définition des pépins ou les pépins sont-ils suffisamment petits pour que le processus d'ingestion crée l'illusion qu'il n'y a pas de pépins ?

Si ce dernier est vrai, le raisin sans pépins est-il capable de germer ?

Enfin, la partie fruit du raisin semé sert-elle d'incitation pour les animaux à l'ingérer et à fournir des nutriments aux graines sous forme de matières fécales, ou peut-elle fonctionner comme un nutriment lui-même ?

Merci


Le raisin sans pépins a techniquement une graine, mais la graine n'a pas d'enveloppe extérieure dure et est microscopique/invisible. Ces graines ne sont pas viables. Techniquement, vous pouvez isoler le tissu de la graine du raisin et le cultiver dans un milieu de germination spécialisé, mais ce processus fonctionne également pour toute autre partie du plant de raisin. Hourra boutures! Certes, le raisin sans pépins ne pousserait pas si vous le mettez en terre.

La partie fruit du raisin ensemencé est un «appât» pour amener les animaux à ingérer le raisin et à transporter les graines à l'intérieur de leur tube digestif. L'objectif est la distance, mais les matières fécales environnantes fournissent des nutriments supplémentaires. Le fruit n'est pas conçu pour nourrir le raisin des semis, mais plutôt pour servir d'appât pour les herbivores. Le raisin est principalement composé de sucres et d'eau, ce qui en fait un excellent appât mais pas un aliment végétal étonnant. Les plantes peuvent fabriquer du sucre à partir du soleil et extraire l'eau du sol, mais l'azote et le phosphore sont plus difficiles à trouver.

Comparez les fruits (qui sont destinés aux animaux) avec les noix de coco, qui sont des exemples de gros fruits stockant beaucoup de calories pour le semis lui-même. La chair de la noix de coco n'est pas aussi sucrée que les fruits et elle est beaucoup plus difficile à atteindre.


La sélection conventionnelle en raisin est fastidieuse et chronophage. La longue phase juvénile du raisin retarde la première floraison et la nouaison. L'utilisation d'outils génomiques, notamment le génie génétique, la génomique fonctionnelle, l'association à l'échelle du génome et la bioinformatique, facilitent l'exploitation des caractères pour raccourcir les cycles de reproduction. Des cycles de reproduction courts peuvent être obtenus par la sélection et le criblage des meilleurs cultivars de la banque de gènes. Cependant, développer de nouveaux cultivars prend du temps. L'incorporation des caractères au nouveau cépage se fait par sélection conventionnelle en croisant des parents mâles et femelles aux caractères contrastés. De plus, l'application de marqueurs moléculaires peut facilement identifier les loci de traits quantitatifs (QTL) influençant les traits d'intérêt pour la fixation de l'introgression dans les cultivars de raisin receveurs par la méthode de rétrocroisement. Le génie génétique est un autre outil qui utilise Agrobacterium tumefaciens et la transformation à médiation biologique par laquelle des gènes ciblés sont insérés dans un ADN d'un nouveau cultivar de raisin pour la régénération, par exemple, des transgènes de raisin. Dans une étude d'hybridation, dans laquelle un cultivar sans pépins est utilisé comme génotype maternel, une technique de sauvetage d'embryons est nécessaire. Certains traits pris en compte dans la sélection du raisin comprennent la période de floraison, le rendement, la tolérance à la sécheresse, la résistance aux maladies, la teneur en sucre et la qualité du vin. Par conséquent, l'application d'outils de génie génomique et génétique est inévitable pour l'amélioration du raisin.

Mots clés: Biotechnologie, Sélection, Germplasm, Marqueur moléculaire, QTL, Trait.


VOIR l'article

  • 1 Laboratorio de Biolog໚ Molecular y Biotecnolog໚ Vegetal, Departamento de Genética Molecular y Microbiolog໚, Pontificia Universidad Católica de Chile, Santiago, Chili
  • 2 Nྫྷleo de Investigación en Producción Alimentar໚, Facultad de Recursos Naturales, Escuela de Agronomón, Universidad Católica de Temuco, Temuco, Chili
  • 3 Ecophysiologie et génomique fonctionnelle de la vigne, Institut des Sciences de la Vigne et du Vin, Institut National de la Recherche Agronomique, Université de Bordeaux, Bordeaux, France

Le développement du fruit de la vigne est un processus dynamique qui peut être divisé en trois étapes : la formation (I), le retard (II) et la maturation (III), au cours desquelles des changements physiologiques et biochimiques se produisent, conduisant à la différenciation cellulaire et à l'accumulation de différents solutés. Ces étapes peuvent être positivement ou négativement affectées par de multiples facteurs environnementaux. Au cours de la dernière décennie, des efforts ont été déployés pour comprendre le développement des baies d'un point de vue global. Une attention particulière a été portée aux réseaux transcriptionnels et métaboliques associés au contrôle du développement des baies de raisin et à la manière dont les facteurs externes affectent le processus de maturation. Dans cette revue, nous nous concentrons sur l'intégration d'approches globales, y compris la protéomique, la métabolomique et surtout la transcriptomique, pour comprendre le développement des baies de raisin. Plusieurs aspects seront considérés, notamment le développement des graines et la production de véraison de fruits sans pépins, au cours de laquelle l'accumulation d'anthocyanes commence dans la peau des baies des variétés colorées et la régulation hormonale du développement des baies et la signalisation tout au long de la maturation, en se concentrant sur la régulation transcriptionnelle des récepteurs hormonaux, des protéines les kinases et les gènes liés à la détection des messagers secondaires. Enfin, les réponses des baies à différents facteurs environnementaux, y compris les stress abiotiques (température, stress hydrique et rayonnement UV-B) et biotiques (champignons et virus), et comment ils peuvent modifier de manière significative à la fois le développement et la composition des fruits de la vigne, seront discuté. Jusqu'à présent, des progrès ont été réalisés grâce à l'application d'outils Omics à différents niveaux moléculaires. Cependant, le potentiel de ces technologies ne doit pas se limiter à l'étude de questions à un seul niveau, les données obtenues par ces plateformes doivent être intégrées pour démêler les aspects moléculaires du développement de la vigne. Par conséquent, le défi actuel est la génération de nouveaux outils qui intègrent des données à grande échelle pour évaluer de nouvelles questions dans ce domaine et pour soutenir les pratiques agronomiques.


Identification à l'échelle du génome, analyse phylogénétique et profilage d'expression de de type CONSTANS (COL) Gènes dans Vitis vinifera

Les CONSTANTE (CO) joue un rôle important dans la floraison des plantes. Cependant, les autres rôles précis du CO gène sont mal compris. Nous avons effectué un recensement génomique et une analyse des profils d'expression pour de type CONSTANS gènes dans Vitis vinifera (VviCOL) pour révéler les caractéristiques moléculaires de VviCOL. Douze VviCOL ont été identifiés et 11 de leurs ADN complémentaires complets ont été clonés. L'alignement de séquences multiples a suggéré la VviCOL contenait des domaines conservés B-box et CCT. Nous avons en outre classé les VviCOL en trois groupes selon la variabilité du second domaine B-box. L'analyse de synthèse a montré que huit paires de gènes orthologues ont été identifiées entre la vigne et Arabidopsis, suggérant que huit paires peuvent descendre d'un ancêtre évolutif commun. Analyse de l'expression tissulaire de COL gènes dans le cv. Le Pinot Noir a montré VviCOL11a et VviCOL11b étaient spécifiquement exprimés dans les boutons floraux, alors que VviCOL16b n'était exprimé qu'en feuilles. Dix VviCOL ont été exprimés dans l'ovule en développement et six d'entre eux ont montré une expression plus élevée dans l'ovule du cv. Thompson Seedless que celui du cv. Pinot Noir, indiquant que VviCOL ont été impliqués dans le processus de développement des graines ou d'avortement des ovules. De plus, neuf des douze VviCOL ont été exprimés en cv. Les feuilles de pinot noir et tous ces neuf gènes ont répondu à l'application d'hormones exogènes. En résumé, nos résultats fournissent un nouvel aperçu des études ultérieures sur les VviCOL, en particulier en termes de développement des graines et de réponse hormonale.

Ceci est un aperçu du contenu de l'abonnement, accessible via votre institution.


Nanofertilisants pour une production fruitière durable : une revue

La demande d'aliments de qualité devrait augmenter avec l'augmentation de la population à travers le monde. Les fruits sont une source majeure de nutraceutiques, mais l'épuisement des nutriments dans les sols altère la culture des fruits. Les engrais conventionnels ont augmenté la production alimentaire après la révolution verte, mais l'agriculture intensive a induit la dégradation des sols et la contamination des aliments par les pesticides. Les engrais conventionnels sont peu efficaces et seulement environ 20 % ou moins de l'engrais appliqué est utilisé par la plante cultivée, le reste étant minéralisé ou lessivé dans les eaux souterraines et les rivières, ce qui entraîne des problèmes de coût, d'eutrophisation et de santé humaine. Alternativement, les nanofertilisants semblent prometteurs car les nanoparticules présentent des propriétés uniques en raison de leurs caractéristiques physico-chimiques à l'échelle nanométrique. Ici, nous passons en revue les applications des nanoparticules dans les cultures fruitières. Les avantages comprennent la productivité, la qualité et la durée de conservation des fruits grâce à leurs effets positifs sur les traits anatomiques, morphologiques, physiologiques, physico-chimiques et moléculaires. Nous discutons également du rôle des nanofertilisants dans l'expression, la régulation et la translocation des gènes pour atténuer les stress abiotiques.

Ceci est un aperçu du contenu de l'abonnement, accessible via votre institution.


Conclusion

Cette étude transcriptomique comparative a révélé un changement plus substantiel dans le profil du transcriptome des feuilles RG que dans les feuilles SY au cours des premiers stades de l'infection par B. cinerea (fig.8 8 ). Certains des mécanismes de défense putatifs sont les suivants : (1) les réponses de défense précoces liées aux parois cellulaires pourraient faciliter la résistance des feuilles de SY à B. cinerea (2) Les processus d'accumulation de ROS et de mort cellulaire facilitent la sensibilité des feuilles de RG à B. cinerea (3) régulation de la voie ABA et des gènes sensibles aux ROS par WRKY et MYB les gènes pourraient jouer un rôle dans la résistance de la vigne (4) différentes réponses en termes de métabolisme C/N pourraient contribuer aux niveaux de résistance contrastés (5) les attributs de pré-infection des feuilles SY contribuent à une plus grande B. cinerea résistance en raison de l'expression basale plus élevée des gènes associés au métabolisme C/N, au métabolisme antioxydant et à l'immunité contre B. cinerea par rapport à celles des feuilles de RG et (6) une expression basale élevée de VaWRKY10 dans la vigne devrait aider à se défendre contre B. cinerea.

une et b montrent les mécanismes de défense putatifs des feuilles RG et SY infectées, respectivement. Le texte en bleu indique les gènes dont l'expression a été régulée à la baisse ou les bioprocédés associés à des ensembles de gènes dont l'expression a été régulée à la baisse. Le texte en rouge indique une expression régulée à la hausse, des activités accrues de CAT et de POX, ou des niveaux accrus d'ABA et de ROS. Le texte en bleu clair et rose montre une légère expression régulée à la baisse et à la hausse, respectivement, et le texte en jaune n'indique aucune différence significative dans l'expression, les activités de CAT et POX et les niveaux de ROS. c et montrent des différences d'expression basale entre les feuilles de contrôle RG et SY. Le texte en bleu représente une expression basale relativement faible. Le texte en rouge indique une expression basale relativement élevée, des activités CAT et des niveaux de ROS. Le jaune indique qu'il n'y a pas de différence significative. RG Vitis vinifera CV. Globe rouge, SY V. amurensis Shuangyou


Matériaux et méthodes

Matières raisins, B. cinerea tests de maladies et études physiologiques

Des plants de RG, SY et Thompson Seedless ont été conservés dans un vignoble supervisé par le programme de germoplasme et de sélection du raisin à la Northwest A&F University, Shaanxi, Chine. Les analyses de feuilles de vigne et de baies détachées, l'analyse statistique et le microexamen du développement des champignons et des lésions ainsi que la mesure des activités CAT et POD ont tous été effectués comme décrit précédemment 7 . La détection des niveaux d'ABA a été effectuée à l'aide d'un système de chromatographie liquide à haute pression (HPLC) dans un centre d'essai de l'Université agricole de Chine, comme décrit précédemment 48 . Niveaux de H2O2, la MDA, les protéines et la chlorophylle ont été mesurées à l'aide de méthodes précédemment publiées 49 .

Extraction d'ARN

Des échantillons ont été collectés à partir de trois réplicats biologiques au fil du temps, et l'extraction de l'ARN total a été réalisée à l'aide d'un E.Z.N.A. Kit ARN végétal (Omega Bio-tek, Norcross, GA, USA). La qualité et la quantité d'ARN ont été évaluées sur un gel d'agarose dénaturé à 1,2 % et un spectrophotomètre NanoDrop 1000 (Thermo Scientific, Wilmington, DE, USA), respectivement.

Séquençage Illumina et traitement des données

Des bibliothèques d'ARN-seq de raisin spécifiques au brin ont été construites par Polar Genomics Company et séquencées via le mode à extrémité unique sur une plate-forme Illumina HiSeq 2000/2500 50 . Un total de 5 à 10 millions de lectures d'une longueur de 100 pb ont été générés pour chaque bibliothèque. La lecture brute et le filtrage des transcrits ont été effectués comme décrit précédemment 51 , et les transcrits finals assemblés ont été alignés sur le génome 12 × PN40024 et B. cinerea B05.10 assemblages de génomes 52,53 utilisant BLAT 54, avec une identité de séquence ≥ 97%. Après l'alignement, le nombre de lectures cartographiées de chaque échantillon a été dérivé et normalisé en lectures par kilobase de modèle d'exon par million de lectures cartographiées (RPKM). Gènes exprimés de manière différentielle entre B. cinerea-les échantillons inoculés et les échantillons témoins ont été identifiés à l'aide du package DESeq 1.8.3 55 . Des gènes avec un ajustement P une valeur ≤ 0,05 et un changement d'expression d'au moins deux fois ont été considérés comme des DEG.

L'analyse des données

Le système « Calculer et dessiner des diagrammes de Venn personnalisés » (http://bioinformatics.psb.ugent.be/webtools/Venn/) a été utilisé pour construire des diagrammes de Venn. Les corrélations et l'ACP entre les échantillons ont été effectuées à l'aide d'un outil en ligne (http://www.omicshare.com/tools). Les catégories d'ontologie génétique (GO) associées aux ensembles de DEG ont été déterminées à l'aide du système Plant MetGenMAP 56 . Le regroupement des gènes a été effectué par regroupement K-means à l'aide du logiciel Genesis 57 . Les TF ont été confirmées en ligne à l'aide de l'alignement Hmmscan (http://www.plantTFdb/animalTFdb). Les sites de liaison TF (TFBS) dans les séquences de promoteur correspondant à la région 2 kb en amont du site de démarrage de la transcription des gènes ont été analysés à l'aide de la base de données JASPAR 58,59. Un test hypergéométrique a été utilisé pour générer P valeurs ajustées à l'aide de la correction de Benjamini-Hochberg 24 . WGCNA a été réalisée comme décrit précédemment 27 .

QRT-PCR et PCR par transcription inverse semi-quantitative

Les amorces ont été conçues à l'aide du logiciel Primer 5 60 L'extraction d'ARN, le traitement à la DNase et la transcription inverse ont été effectués comme décrit précédemment 61 . Les analyses qRT-PCR ont été réalisées en utilisant SYBR Premix Ex Taq II (TaKaRa Biotechnology) sur un thermocycleur Bio-Rad iQ5 (Bio-Rad, Hercules, CA, USA). VvActine1 (ID : XM_002282480.4 séquence d'amorce, F : GATTCTGGTGATGGTGGTAGT, R : GACAATTTCCCGTTCAGCAGT) et AtActin1 (ID : séquence d'amorce AT2G37620, F : GGCGATGAAGCTCAATCCAAACG, R : GGTCACGACCAGCAAGATCAAGACG) ont été utilisés comme gènes de référence. Journal relatif2 les taux d'induction des échantillons traités par rapport à ceux du traitement témoin ont été calculés sur la base de la DD t méthode 48 . Trois réplicats biologiques et trois réplicats techniques ont été analysés pour chaque expérience. La PCR par transcription inverse semi-quantitative a été réalisée comme décrit précédemment 28, chaque réaction étant répétée trois fois et les trois analyses indépendantes montrant les mêmes tendances pour chaque gène et échantillon.

Transformation de A. thaliana et V. vinifera avec VaWRKY10

VaWRKY10 et VvWRKY10 les séquences codantes ont été amplifiées comme décrit précédemment 61 en utilisant PrimeSTAR HS DNA Polymerase (TaKaRa Biotechnology) avec des amorces spécifiques du gène (F: 5′-CGGGATCCATGGAATTCGAATTTATTGATAC-3′, BamH I site souligné R: 5′-TCCCCCGGGTCACCATTTTTCTATCTGAG-3′, Sma Je site souligné). Les séquences ont été analysées à l'aide du programme BLAST (http://Ncbi.nlm.Nih.gov/blast) de la base de données NCBI61. Les VaWRKY10 La séquence codante a ensuite été fusionnée au promoteur CaMV 35S dans un vecteur pCAMBIA2300 61 . Le pCAMBIA2300-35S-VaWRKY10 vecteur a ensuite été introduit dans A. thaliana en utilisant la méthode floral-dip, et 75 mg/L de kanamycine ont été utilisés pour l'identification des semis transgéniques 62 . Les A. thaliana les plantes ont été cultivées sous 50-60% d'humidité relative à 21-23 °C et une photopériode de jours longs (16 h de lumière/8 h d'obscurité). Le pCAMBIA2300-35S-VaWRKY10 vecteur de surexpression a ensuite été introduit dans A. tumefaciens souche GV3101. A. tumefaciens des cultures contenant le plasmide ont été utilisées pour transformer des embryons somatiques du génotype de raisin Thompson Seedless (Fig. 6c) La propagation des plantules a été réalisée à 25 ± 1 °C et une photopériode de 16 h 38 .

A. thaliana et Thompson sans pépins B. cinerea tests de résistance

Des tests de feuilles détachées 7 ont été utilisés pour identifier les niveaux de résistance à B. cinerea de feuilles de même taille de transgéniques de 4 semaines A. thaliana semis, semis Thompson Seedless transgéniques âgés de deux mois et leurs lignées WT correspondantes. Trois répétitions biologiques ont été analysées. Gouttelettes contenant 1,5 × 10 6 /mL B. cinerea les spores ont été appliquées sur 15-18 A. thaliana feuilles par répétition, et l'infection a été évaluée quatre jours après l'inoculation en mesurant le diamètre de la zone de propagation des lésions 61 . B. cinerea des suspensions de spores contenant 1,5 × 10 6 spores/mL ont été pulvérisées sur 15 à 18 feuilles de vigne Thompson sans pépins par répétition. L'infection a ensuite été évaluée en calculant le pourcentage de lésions étalées sur chaque feuille 7 .


Résumé

La sérotonine est une ancienne indoléamine qui faisait vraisemblablement partie du cycle de vie des premières formes de vie procaryotes sur Terre il y a des millions d'années, où elle fonctionnait comme un puissant antioxydant pour lutter contre l'atmosphère de plus en plus riche en oxygène. D'abord identifié comme une molécule de signalisation des neurotransmetteurs chez les mammifères, il est omniprésent dans toutes les formes de vie. La sérotonine a été découverte dans les plantes de nombreuses années après sa découverte chez les mammifères, mais elle a maintenant été confirmée dans presque toutes les familles de plantes, où elle joue un rôle important dans la croissance et le développement des plantes, notamment des fonctions d'acquisition d'énergie, de cycles saisonniers, de modulation du développement reproducteur, contrôle de l'organogenèse des racines et des pousses, maintien des tissus végétaux, retard de la sénescence et réponses aux stress biotiques et abiotiques. Malgré sa présence et son activité généralisées, de nombreuses questions restent sans réponse sur le rôle de la sérotonine dans les plantes, notamment le mode de signalisation et l'identité du récepteur ainsi que les mécanismes d'action de cette molécule importante. Cette revue donne un aperçu du rôle de la sérotonine dans la vie des plantes et de leur capacité d'adaptation.


Réponses morphologiques et physiologiques de tara (Caesalpinia spinosa (Mol.) O. Kuntz) des micropousses aux traitements de ventilation et de saccharose

L'un des principaux problèmes de in vitro la culture de tissus végétaux est la mauvaise ventilation dans les récipients de culture. Cela conduit à des anomalies morphologiques et physiologiques dans les in vitro plantes, un enjeu crucial pour les espèces ligneuses, comme Caesalpinia spinosa (Mol.) O. Kuntz, qui est un arbre légumineux ou arbuste épineux des Andes, photoautotrophe et photomixotrophe adéquats in vitro les systèmes d'enracinement pourraient éliminer ces problèmes. Par conséquent, le but de la présente étude était d'évaluer les traitements photoautotrophes et photomixotrophes pour optimiser la in vitro enracinement de C. spinosa micro pousses. Les pousses micropropagées ont été cultivées dans des récipients scellés avec un couvercle en polypropylène avec 0, 1 ou 3 trous de ventilation recouverts d'un microfiltre en polypropylène adhésif de 0,45 µm. Les récipients contenaient des sels MS avec ou sans 30 g L -1 de saccharose ou, à défaut, un substrat poreux (PRO-MIX®), qui facilitait l'enracinement et produisait des poids frais et secs plus importants, une concentration plus élevée de pigments photosynthétiques et de composés phénoliques, et feuilles plus développées. Les performances optimales et une survie plus élevée ont été obtenues en utilisant PRO-MIX® avec trois filtres pour une ventilation accrue. Pour les traitements en gélose, seul celui au saccharose et très ventilé (trois filtres) a atteint une performance proche de celle du PRO-MIX®. À ce jour, les résultats présentés n'ont pas été rapportés dans la littérature scientifique pour C. spinosa.

Ceci est un aperçu du contenu de l'abonnement, accessible via votre institution.


13 - Irradiation des fruits et légumes frais

L'irradiation des aliments est un procédé à froid pour la conservation des aliments et a été établie comme une méthode sûre et efficace de transformation et de conservation des aliments après plus de cinq décennies de recherche et développement. Bien qu'un consensus ait été atteint depuis un certain temps dans la communauté scientifique sur la salubrité de l'irradiation gamma des aliments, le grand public reste préoccupé par cette technologie même si un certain nombre de rapports récents montrent un intérêt croissant pour l'irradiation des aliments de la part des organismes de réglementation gouvernementaux et de l'industrie et une diminution appréhension du public. L'irradiation des aliments n'est pas une nouvelle technologie. Aujourd'hui, il est approuvé par plus de 40 pays pour plus de 100 aliments ou groupes d'aliments irradiés destinés à la consommation. Ce chapitre traite de l'action des rayonnements ionisants, des sources de rayonnements ionisants et des concepts de dose et des différents niveaux de dose utilisés dans le traitement des rayonnements. Il comprend également les désinfestations, la prolongation de la durée de conservation, la décontamination et les avantages et inconvénients de l'irradiation des aliments, avec un accent particulier sur les applications des fruits et légumes dans le cadre de l'irradiation. Le chapitre passe en outre en revue l'état actuel des méthodes analytiques utilisées dans la détection des fruits et légumes irradiés dans le cadre des méthodes de détection analytique et présente un résumé des applications relatives à la conservation des fruits et légumes.


Voir la vidéo: - Les graines, les fruits et la germination (Août 2022).