Informations

Comment homogénéiser un petit culot de 10 à 50 cellules en moins de 50 µL ?

Comment homogénéiser un petit culot de 10 à 50 cellules en moins de 50 µL ?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

J'ai un problème avec le dégroupage/homogénéisation des cellules bactériennes en petits volumes (10 à 50 µL). Je sais que je peux retirer toutes mes cellules du tube, mais elles sont toujours collées ensemble et ne formeront pas de colonies séparées sur une boîte de gélose.
Je le sais parce que lorsque je prends les 50 derniers µl d'un tube de 1 ml et que je les mets dans un nouveau tube et que je mélange les 50 µL avec un plus grand volume (par exemple 100 µL), nous obtenons un nombre d'UFC plus élevé.


Depuis la découverte de la composition et de la structure de la membrane cellulaire des mammifères, les biologistes ont une meilleure compréhension de la façon dont les substances entrent et sortent de l'intérieur de la cellule. La nature sélectivement perméable de la membrane cellulaire permet le mouvement de certains solutés et empêche le mouvement des autres. Ceci a des conséquences importantes pour le volume cellulaire et l'intégrité de la cellule et, par conséquent, est d'une importance clinique de la plus haute importance, par exemple dans l'administration de perfusions intraveineuses isotoniques. Les concepts d'osmolarité et de tonicité sont souvent confondus par les étudiants car les solutés isosmotiques imperméants tels que NaCl sont également isotoniques. Cependant, les solutés isosmotiques tels que l'urée sont en réalité hypotoniques en raison de la nature perméable de la membrane. En plaçant des globules rouges dans des solutions d'osmolarités et de tonicités différentes, cette expérience démontre les effets de l'osmose et les changements qui en résultent dans le volume cellulaire. En utilisant des solutions étalons d'hémoglobine, où des concentrations connues d'hémoglobine sont produites, la proportion d'hémolyse et l'effet de celle-ci sur l'hématocrite résultant peuvent être estimés. Aucune modification du volume cellulaire ne se produit dans le NaCl isotonique et, en plaçant les cellules sanguines dans du NaCl hypotonique, une hémolyse incomplète se produit. En changeant la solution de bain en eau distillée ou en urée isosmotique, une hémolyse complète se produit en raison de leurs effets hypotoniques. Avec l'utilisation de sang animal dans cette pratique, les étudiants acquièrent une expérience utile dans la manipulation des fluides tissulaires et le calcul des dilutions et peuvent apprécier la science derrière les scénarios cliniques.

le mouvement de l'eau et des petites molécules à travers les membranes sélectivement perméables des cellules de mammifères est un concept fondamental de la physiologie. Ces processus peuvent être difficiles à visualiser et à apprécier pour les élèves, et c'est souvent aux images des manuels ou des animations en ligne d'expliquer ces mouvements. Cette pratique utilise du sang animal baigné dans des solutions d'osmolarités et de tonicité différentes pour explorer le concept de mouvement de l'eau par osmose et l'hémolyse qui en résulte qui peut se produire lorsque les globules rouges sont exposés à des solutions hypotoniques. Les étudiants ont la possibilité de manipuler des fluides corporels, de s'entraîner à préparer des dilutions et de faire des observations précises.


INTRODUCTION

La diversité qui en résulte permet aux histones de jouer un rôle clé dans presque tous les processus transcriptionnels, et le dérèglement de ces processus a été associé à diverses maladies. En particulier, des altérations transcriptionnelles ont été notées dans le cancer, où elles ont été associées à sa progression, son agressivité et ses métastases, et sont utiles dans son pronostic (Dawson & Kouzarides, 2012). Une compréhension approfondie des variantes et des protéoformes des histones est donc nécessaire pour comprendre à la fois la fonction cellulaire normale et la maladie. Un problème clé, cependant, est que les méthodes d'analyse PTM conventionnelles ne capturent pas les protéoformes. Une approche protéomique intermédiaire ou descendante à haut débit est plutôt nécessaire pour répondre à ces questions (Holt et al., 2019 Wang, Holt, & Young, 2018 ). Dans ces approches protéomiques, la queue N-terminale ou la protéine entière est analysée intacte et les relations entre les PTM sont maintenues, et ainsi, les informations au niveau de la protéoforme sont capturées.

L'étape de préparation des échantillons est devenue un goulot d'étranglement pour les stratégies actuelles d'analyse des PTM d'histones. La plupart des protocoles antérieurs ne sont pas optimisés pour de faibles quantités d'échantillons et sont souvent assez inefficaces avec des volumes d'échantillons plus importants. De plus, beaucoup ont inclus des temps d'incubation sensiblement longs dans l'attente d'une efficacité améliorée avec des temps plus longs, cependant, nous avons constaté que des temps plus courts sont à la fois rapides et également ou même plus efficaces. La vitesse limite également les processus de dégradation, comme l'oxydation.

Les protocoles décrits ici sont une optimisation et une extension des protocoles précédents d'extraction d'histones progressivement améliorés sur plus de 130 ans (Kossel, 1884 Shechter, Dormann, Allis et Hake, 2007). Nous décrivons deux protocoles qui ont été rationalisés et optimisés pour trois quantités différentes de cellules de culture tissulaire de départ. Dans le protocole de base 1, les cellules sont lysées, les noyaux sont isolés et les histones sont extraites à l'acide. Dans le protocole de base 2, les histones sont purifiées et séparées par famille d'histones avec chromatographie liquide haute performance en phase inversée (HPLC), et l'histone H4 est protéoforme résolue par HPLC et analysée par spectrométrie de masse descendante. De plus, nous décrivons brièvement un protocole pour obtenir des queues d'histone H3 intactes pour la protéomique intermédiaire (protocole de support).

Ces protocoles peuvent être utilisés avec plusieurs autres protocoles protéomiques pour l'analyse des histones (Chen et al., 2016 Dang et al., 2014 Dang et al., 2016 Gargano et al., 2018 Holt, Wang, & Young, 2019 Moradian , Kalli, Sweredoski, & Hess, 2014 Plazas-Mayorca et al., 2009 Sidoli & Garcia, 2017 Sidoli, Bhanu, Karch, Wang, & Garcia, 2016 Wang et al., 2018 Young et al., 2009 Zhou et al. , 2019 ). Ils sont également utiles pour une variété d'applications non protéomiques. Nos objectifs dans le développement de ces protocoles étaient 1) d'augmenter le débit, de sorte que l'intégralité du pipeline puisse être effectuée en une seule journée 2) de réduire les besoins en échantillons, de sorte que de petits échantillons de tissus puissent être analysés avec succès et 3) de ne pas compromettre les données qualité et reproductibilité. L'opportunité de ces protocoles en fait un excellent choix pour d'autres approches de biologie de la chromatine qui sont limitées par la taille ou le débit de l'échantillon. Même en l'absence de contraintes d'échantillon et de débit limitantes, l'utilisation de ces protocoles accélérera et simplifiera considérablement l'extraction des histones sans aucun coût de qualité observé.


Protocole

1) Marquage des cellules

  1. Préparer des suspensions cellulaires.
    • Ce protocole a été optimisé à l'aide de PBMC humaines fraîches isolées à l'aide de gradients de Ficoll et de splénocytes de souris préparés par dissociation mécanique. Si vous utilisez des cellules isolées de sang total lysé ou d'autres types d'échantillons, les utilisateurs peuvent avoir besoin d'optimiser les concentrations de coloration.
    • BioLegend n'a pas testé ce protocole en utilisant des suspensions monocellulaires dérivées de tissus digérés par voie enzymatique. La digestion enzymatique peut entraîner le clivage des épitopes et une coloration réduite avec les anticorps TotalSeq&trade. L'optimisation des conditions de coloration et des concentrations peut être nécessaire.
  2. Évaluer la viabilité cellulaire.
    • Comptez soigneusement toutes les cellules pour assurer une quantification précise et évaluer la viabilité des cellules.
    • La viabilité cellulaire idéale est de 95 %.
      • Une faible viabilité cellulaire est associée à la génération de données médiocres et n'est pas idéale pour l'expérimentation sur une seule cellule.
      • Si une faible viabilité cellulaire est observée, les utilisateurs peuvent avoir besoin d'enrichir les cellules vivantes ou de répéter la préparation de la suspension cellulaire.
    • Contactez les services techniques pour toute question concernant la viabilité des cellules. BioLegend utilise Countess II pour compter et évaluer la viabilité cellulaire à l'aide du protocole suivant, mais d'autres méthodes d'évaluation de la viabilité cellulaire conviennent. Pour plus d'informations sur le protocole utilisé par BioLegend, voir le lien suivant, les détails peuvent être trouvés sous &ldquoévaluation de la viabilité des PBMC&mdashméthodes générales&rdquo.
  3. Diluer les cellules dans un volume approprié avant la coloration.
    • Si vous travaillez avec des cellules humaines, diluer 1 million de cellules dans 45 & l de Cell Staining Buffer dans des tubes de cytométrie en flux 12 x 75 mm.
    • Si vous travaillez avec des cellules de souris, diluez 1 million de cellules dans 49,5 & ul de Cell Staining Buffer dans des tubes de cytométrie en flux 12 x 75 mm.
  4. Bloquer les cellules.
    • Ajouter 5 µl de réactif de blocage humain TruStain FcX&trade Fc ou 0,5 µl d'anticorps TruStain FcX&trade PLUS (anti-souris CD16/32). Le volume de blocage final doit être de 50 µl.

Remarque : Nous ne recommandons plus l'utilisation de dextrane ou de bloqueur de monocytes pendant le blocage/la coloration. Si vous avez des questions, veuillez contacter le support technique de BioLegend.

  • Si vous utilisez des anticorps biotinylés, nous vous recommandons de commencer par une coloration avec votre anticorps primaire, suivie d'une coloration avec des conjugués de streptavidine TotalSeq&trade. Ne pas colorer avec plus d'un anticorps biotinylé unique à utiliser pour la détection.
  • Si vous utilisez un cocktail d'anticorps supérieur à 50 & microL, contactez les services techniques ou les scientifiques des applications techniques locales pour obtenir des conseils sur le protocole avant de poursuivre avec ce protocole.
  • Transférer la plaque de lavage Curiox dans le système de lavage laminaire Curiox et laver en utilisant les paramètres suivants (débit : 10, nombre de cycles : 25)
  • Retirer la plaque de lavage Curiox du système et ajouter 40 & mul de tampon de lavage dans le puits contenant les cellules lavées.
  • Remettre en suspension en pipetant doucement.
  • Passez à l'étape 11.
  • BioLegend recommande l'utilisation d'une centrifugeuse à godets pivotants, car la centrifugation avec des rotors à angle fixe peut entraîner un &ldquosmearing&rdquo du culot cellulaire, ce qui peut entraîner une perte de cellules. Contactez le technicien ou le représentant local si vous avez des questions.
  • BioLegend recommande de verser manuellement le surnageant en veillant à ne pas perturber le culot cellulaire. Entre 50 et 150 µL de surnageant résiduel restera dans le tube après décantation, ce qui est pris en considération à l'étape 11 de ce protocole. N'essayez pas de retirer avec force tout liquide restant car cela perturberait le culot cellulaire et entraînerait une perte de cellules.

Remarque : Le filtre cellulaire Flowmi&trade 40 microm peut être trop petit pour certains types d'échantillons.

Remarque : si vous utilisez 10x Genomics Chromium Controller pour le partitionnement d'une seule cellule, nous vous recommandons fortement de déterminer la viabilité des cellules. Idéalement, la viabilité devrait être de >90% après filtration pour un taux de capture optimal. La présence d'un grand nombre de cellules non viables peut diminuer l'efficacité de la partition et de la récupération des cellules dans la puce 10x Genomics Chromium.

II) Exécutez le test 10x Genomics single cell 3 & 39 v3 ou v3.1 comme décrit par Post Gem-RT Cleanup & ndash Dynabeads (étape 2.1). 10x documents de génomique CG000185_Rev_D pour le test v3 ou CG000206_Rev_D pour v3.1.

À l'étape d'amplification de l'ADNc (étape 2.2), utilisez le tableau suivant :

ADT 1 rxn (µl) HTO 1rxn (µl) ADT + HTO 1 rxn (µl)
Mélange d'amplis 50 50 50
Amorces d'ADNc* 15 15 15
ADT Additive Primer (stock 0.2 & microM) 1 0 1
Primer additif HTO v2 (stock de 0,2 uM) 0 1 1
Le total 66 66 67

* inclus avec le kit 10x Genomics 3&rsquo, différent des amorces d'ADNc Feature 2.

Suivez exactement les étapes 2.3A et 2.3B pour séparer les ADT/HTO de l'ADNc. Continuez à utiliser 70 & microL de billes sparQ ou SPRI à l'étape 2.3B.

Voir les notes à la fin du protocole pour plus de détails sur les séquences d'amorces.

III) Préparation des bibliothèques d'ADT et d'ARNm

Remarque : Pour les échantillons contenant à la fois de l'ADT et de l'HTO, effectuez deux réactions distinctes et ajoutez 5 microl de &ldquopurifié ADT/HTO fraction&rdquo du même échantillon à la réaction ADT ou HTO.

  • C) Nettoyage après amplification de la bibliothèque ADT/HTO
  1. Ajouter 120 µl sparQ ou SPRIselect Reagent (1,2X) à chaque échantillon.
  2. Incuber 5 min à température ambiante.
  3. Placer l'aimant en position haute jusqu'à ce que la solution se dissipe.
  4. Retirez et jetez soigneusement le surnageant.
  5. Placez les tubes sur l'aimant en position haute. Laver le culot deux fois avec 200 microlitres d'éthanol à 80 %.
  6. Centrifuger brièvement. Placer sur l'aimant Low. Retirer l'éthanol restant.
  7. Retirer de l'aimant. Ajouter 40,5 µl d'eau.
  8. Incuber 2 min à température ambiante.
  9. Placer l'aimant en position basse jusqu'à ce que la solution se dissipe.
  10. Transférer 40 µl dans une nouvelle barrette tubulaire. Stocker à 4°C jusqu'à 72 h ou à &moins20°C pour un stockage à long terme.
  11. Les bibliothèques ADT/HTO sont maintenant prêtes à être séquencées
    Quantifier les bibliothèques par des méthodes standard (QuBit, BioAnalyzer, qPCR).
    Les bibliothèques ADT seront d'environ 180 pb (figure 1B).


Séquençage des bibliothèques CITE-seq :

Pour obtenir une couverture de lecture suffisante pour les deux bibliothèques, nous séquençons généralement les bibliothèques ADT dans 5 à 10 % d'une piste et une fraction de bibliothèque d'ADNc à 90 % d'une piste (HiSeq2500 Rapid Run Mode Flow Cell). Voir le tableau ci-dessous pour les recommandations de profondeur de séquençage

Profondeur de séquençage minimale
(lecture/cellule)

3 & 39 Bibliothèque d'expression génique

Bibliothèque de protéines de surface cellulaire et panneau ADT lt100

Bibliothèque de protéines de surface cellulaire et panneau ge100 ADT

Anticorps TotalSeq&trade. Chaque clone est codé à barres avec une séquence oligonucléotidique unique. Ceux-ci contiennent 2 séquences standard de lecture d'ARN TruSeq et peuvent être amplifiés à l'aide des ensembles d'amorces Illumina&rsquos Truseq Small RNA (amorces RPIx & ndash, voir l'exemple RPI1 ci-dessous)

CCTTGGCACCCGAGAATTCCA AACAAGACCCTTGAG B AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.


Veuillez visiter https://www.biolegend.com/totalseq pour des informations détaillées :

Oligos requis pour l'amplification de la bibliothèque ADT :

  • La purification PAGE est la méthode préférée lors de la commande d'amorces.
  • Les liaisons phosphorothioate dans l'amorce rendent l'oligonucléotide résistant à la dégradation par la nucléase.
  • Une amorce Illumina unique (index) doit être utilisée pour chaque voie d'échantillons 10x Genomics utilisée dans une voie de séquençage.
  1. 10x amorce SI-PCR génomique 5&rsquoAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC*T*C
  2. ADT cDNA PCR additive primer 5&rsquoCCTTGGCACCCGAGAATT*C*C
  3. HTO cDNA PCR additive primer v2 5&rsquoGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
  4. Amorce Illumina Small RNA RPI1 (pour l'amplification ADT i7 index 1, Séquences oligonucléotidiques, Illumina) 5&rsquoCAAGCAGAAGACGGCATACGAGAT CGTGAT GTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A
  5. Amorce Illumina TruSeq D701_LONG (pour l'amplification HTO i7 index 1) 5&rsquoCAAGCAGAAGACGGCATACGAGAT CGAGTAAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

* indique une liaison phosphorothioate
B indique C ou G ou T pas un nucléotide

Amorces utilisées pour la construction de bibliothèques de séquençage :

Ne pas utiliser avec l'index 10x

CAAGCAGAAGACGGCATACGAGAT CGAGTAAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

CAAGCAGAAGACGGCATACGAGAT TCTCCGGA GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

CAAGCAGAAGACGGCATACGAGAT AATGAGCG GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

CAAGCAGAAGACGGCATACGAGAT GGAATCTC GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

CAAGCAGAAGACGGCATACGAGAT TTCTGAAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

CAAGCAGAAGACGGCATACGAGAT ACGAATTC GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

CAAGCAGAAGACGGCATACGAGAT AGCTTCAG GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

CAAGCAGAAGACGGCATACGAGAT GCGCATTA GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

CAAGCAGAAGACGGCATACGAGAT CATAGCCG GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

CAAGCAGAAGACGGCATACGAGAT TTCGCGGA GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

CAAGCAGAAGACGGCATACGAGAT GCGCGAGA GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

CAAGCAGAAGACGGCATACGAGAT CTATCGCT GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

CAAGCAGAAGACGGCATACGAGAT CGTGAT GTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

CAAGCAGAAGACGGCATACGAGAT ACATCG GTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

CAAGCAGAAGACGGCATACGAGAT GCCTAA GTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

CAAGCAGAAGACGGCATACGAGAT TGGTCA GTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

CAAGCAGAAGACGGCATACGAGAT CACTGT GTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

CAAGCAGAAGACGGCATACGAGAT ATTGGC GTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

CAAGCAGAAGACGGCATACGAGAT GATCTG GTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

CAAGCAGAAGACGGCATACGAGAT TCAAGT GTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A


COMMENTAIRE

Informations d'arrière-plan

Paramètres critiques

Il existe des problèmes de sécurité spécifiques à prendre en compte lors de la préparation des grilles marquées à l'or immunologique et de leur élimination. Certains échantillons, y compris certains virus vivants, nécessiteront une manipulation particulière en fonction de leur BSL en raison de leur nature infectieuse. Par exemple, le virus de la grippe pandémique H1N1 nécessite une manipulation BSL-2. De plus, certaines solutions de coloration négative nécessitent une élimination appropriée. Par exemple, l'UA est toxique et contient des traces de radioactivité, et doit donc être éliminé dans les déchets radioactifs. Ces préoccupations doivent être prises en compte lors de la conception des expériences.

De nombreuses variables doivent être correctement optimisées pour préparer avec succès des grilles marquées à l'or immunologique pour la MET (voir Dépannage). Il est également important de noter que l'ordre dans lequel les variables sont optimisées peut grandement affecter la productivité. Il est fortement recommandé d'optimiser d'abord la coloration négative des échantillons non marqués, car l'interprétation de l'étiquetage nécessite un bon contraste par rapport à la coloration négative. Cette technique révélera également la morphologie de base de l'échantillon pour une comparaison avec des échantillons marqués à l'or immunologique. Deuxièmement, les concentrations d'anticorps doivent être optimisées pour assurer un marquage réussi de l'antigène d'intérêt tout en maintenant un faible marquage de fond. Des dilutions d'anticorps en série peuvent être utiles pour identifier une concentration appropriée.

Les contrôles sont essentiels pour interpréter les résultats d'une expérience de microscopie immunoélectronique pour tenir compte du marquage non spécifique et des changements de morphologie qui peuvent survenir en raison de la présence d'anticorps. La préparation des contrôles nécessaires nécessite la réalisation de grilles supplémentaires avec différentes combinaisons d'anticorps, qui doivent être réalisées en même temps que les grilles expérimentales. Une grille de contrôle doit être préparée avec un anticorps primaire dirigé contre un antigène non pertinent produit dans la même espèce hôte que l'anticorps expérimental, suivi du même anticorps secondaire que celui utilisé pour la grille expérimentale. Ce contrôle tiendra compte du marquage non spécifique pour assurer une liaison spécifique à l'antigène cible. Si disponible, l'utilisation d'un anticorps alternatif sur cible d'une espèce différente pourrait être une excellente méthode pour valider les résultats de la microscopie immunoélectronique. Pour contrôler les changements d'apparence d'un complexe lorsqu'il est marqué avec un anticorps, une autre grille de contrôle doit être préparée avec l'anticorps primaire expérimental associé à un anticorps secondaire qui n'est pas conjugué à l'or colloïdal. Ce contrôle indiquera comment la morphologie peut changer en présence d'anticorps. Par exemple, de petites particules peuvent apparaître plus grosses en présence d'anticorps, car les anticorps eux-mêmes peuvent apparaître par coloration négative. Cela peut être vu pour le vaccin viral candidat Flublok (Sanofi Pasteur) dans la figure 2, dans lequel les complexes immunomarqués à l'or semblent plus gros que les complexes non marqués. Si vous effectuez une microscopie immunoélectronique ciblant plusieurs antigènes simultanément (protocole alternatif), la réactivité croisée entre les anticorps doit être testée. Par exemple, lorsqu'une expérience est conçue pour marquer deux antigènes, l'un avec un anticorps de souris et l'autre avec un anticorps de lapin, deux grilles de contrôle supplémentaires sont nécessaires. Dans le premier, l'anticorps primaire de souris doit être utilisé suivi d'un anticorps secondaire conjugué à l'or ciblant le lapin. L'inverse doit être préparé pour la deuxième grille.

Les paramètres d'imagerie TEM sont essentiels pour visualiser avec succès les échantillons marqués à l'or immunologique et interpréter les données. Il est important de s'assurer que le microscope est bien aligné, que les grilles sont imagées légèrement sous mise au point et qu'un grossissement approprié est choisi de telle sorte que plusieurs particules puissent être visualisées dans un champ de vision tout en détectant les détails des particules. Les instructions d'utilisation spécifiques pour la MET dépendent du microscope utilisé et sortent du cadre de cette section.

Dépannage

L'immunomicroscopie électronique comporte plusieurs étapes au cours desquelles des problèmes peuvent survenir. Malheureusement, pour une grille donnée, les erreurs ne deviennent souvent évidentes qu'à la toute fin de la procédure, lorsque les grilles sont imagées par MET. Les problèmes les plus courants qui se produisent sont la mauvaise qualité de l'échantillon, le manque d'étiquetage ou l'étiquetage non spécifique et une mauvaise visualisation de l'échantillon.

La qualité de l'échantillon doit être évaluée par coloration négative de l'échantillon seul avant de commencer les expériences de marquage à l'or immunologique. Les échantillons doivent être correctement optimisés pour la concentration et la distribution sur la grille. La concentration de particules virales, qu'il s'agisse d'un virus, d'une protéine virale purifiée ou d'un vaccin viral, doit être suffisamment faible pour résoudre les particules individuelles, mais suffisamment élevée pour que plusieurs particules puissent être visualisées dans un seul champ de vision au grossissement préféré du microscope. De plus, les particules doivent être bien dispersées pour identifier avec succès à quelle particule les marqueurs d'or colloïdal sont associés. L'échantillon idéal doit être relativement exempt de contamination et peut donc nécessiter des étapes de purification. Lors de la préparation des grilles pour l'imagerie, si un échantillon n'adhère pas bien à la grille, la grille peut être prétraitée avec un agent mouillant, tel que la poly-L-lysine, ou peut être rendue plus hydrophile à l'aide d'une unité de décharge luminescente avant l'application de l'échantillon. Si les détails structurels de l'échantillon ne peuvent pas être résolus en MET avant le marquage à l'or immunologique, la taille des grains de coloration négative peut être trop grande et une coloration avec une résolution plus élevée peut être nécessaire. Par exemple, UA a une taille de grain plus petite et donc une résolution plus élevée que PTA. Pourtant, l'incertitude de l'emplacement d'un épitope par rapport au marqueur d'or dépasse de loin la résolution granulaire de toutes les solutions de coloration négative couramment utilisées. Les différences entre les solutions de coloration négatives courantes sont discutées dans le protocole de support 2. Lors du marquage à l'or immunologique, si plusieurs particules sont à proximité d'un marqueur en or et qu'il n'est pas clair quelle particule a été marquée, la concentration de l'échantillon peut être trop élevée. Dans ce cas, l'échantillon doit être dilué, de préférence avec un tampon pauvre en sel. L'apparence de l'échantillon peut être altérée par une coloration à l'or immunologique en raison des multiples étapes de lavage en présence d'un détergent doux (par exemple, si l'échantillon a une membrane qui peut se déformer). Dans ce cas, l'échantillon peut être fixé avec un agent de réticulation, tel que le paraformaldéhyde ou le glutaraldéhyde, avant l'incubation avec l'anticorps.

Un mauvais étiquetage peut être causé par plusieurs facteurs. Une cause pourrait être s'il y a une très faible concentration d'antigène. Il peut également être causé par un anticorps qui peut avoir perdu sa capacité de liaison, ou il peut y avoir une incompatibilité entre l'anticorps et la solution de blocage ou la solution de coloration négative ultérieure. La liaison de l'anticorps à l'échantillon doit être vérifiée dans ce cas par un autre moyen, tel qu'un dosage immuno-enzymatique (ELISA). La concentration en anticorps pourrait également être augmentée. Si le marquage à l'or sature à un niveau beaucoup plus faible que prévu même avec des concentrations d'anticorps suffisamment élevées (Fig. 4A), il se peut que les antigènes soient très proches les uns des autres et qu'il puisse y avoir un encombrement stérique entre les anticorps voisins et/ou leurs marqueurs à l'or qui empêche des anticorps supplémentaires conjugués à l'or de la liaison. Dans ce cas, il peut être nécessaire d'utiliser une plus petite taille d'anticorps conjugué à l'or colloïdal (par exemple, un anticorps marqué à l'or à 10 nm au lieu de l'anticorps marqué à l'or à 25 nm). Si les marqueurs ne lient pas seulement l'antigène d'intérêt mais sont également présents de manière non spécifique dans l'arrière-plan (figure 4B), les étapes de lavage peuvent être inadéquates, auquel cas des étapes de lavage supplémentaires peuvent être ajoutées. Alternativement, la concentration d'anticorps peut être trop élevée et les anticorps primaires et/ou secondaires peuvent nécessiter une dilution supplémentaire. Si les marqueurs d'or semblent être regroupés sans rapport avec la présentation de l'antigène (Fig. 4B, flèches), cela pourrait être dû à l'amplification naturelle des anticorps secondaires liés aux anticorps primaires, auquel cas une dilution supplémentaire de l'anticorps secondaire peut être effectuée, ou à agglutinés anticorps primaire, auquel cas un nouvel échantillon d'anticorps primaire peut être nécessaire. Une autre solution pour optimiser deux ensembles d'anticorps consisterait à utiliser un anticorps primaire conjugué à l'or colloïdal, ce qui exclut alors le besoin d'utiliser des solutions d'anticorps secondaires. Cela élimine les problèmes de liaison non spécifique par l'anticorps secondaire, bien que la liaison non spécifique de l'anticorps primaire puisse toujours être un problème. Cependant, il existe peu d'anticorps primaires conjugués à l'or colloïdal sur le marché, il peut donc être nécessaire de conjuguer chimiquement l'or colloïdal à un anticorps d'intérêt, ce qui dépasse le cadre de cet article.

Une mauvaise visualisation de l'échantillon peut être causée par une coloration négative trop légère ou trop importante, résultant d'une coloration positive (Ackermann, 2013), ou par du carbone cassé sur la grille elle-même. Les procédures générales de coloration négative doivent être traitées avant de commencer le marquage à l'or immunologique par coloration négative de l'échantillon seul. Les particules colorées négativement avec succès doivent apparaître de couleur claire, avec la tache du support de carbone apparaissant comme sombre. Si les couleurs se sont inversées, lorsque les particules apparaissent comme sombres sur un fond clair, une coloration positive s'est produite et les conditions de coloration négative peuvent devoir être réévaluées. Les solutions possibles incluent la modification de la solution de coloration négative utilisée ou la modification de la concentration de la tache pour modifier la quantité de tache présente sur la grille. Si la coloration est trop faible (Fig. 4C), il sera difficile d'identifier et d'analyser les particules sur la grille dans ce cas, la concentration de coloration négative peut être augmentée. Si la coloration est trop dense, cela pourrait entraîner des difficultés à visualiser l'échantillon sur la grille car l'échantillon peut apparaître opaque ou avoir un faible contraste par rapport à l'arrière-plan (Fig. 4D). Pour y remédier, une étape de lavage peut être effectuée après application de la solution de coloration négative, ou la concentration de la coloration négative peut être abaissée.

Une forte coloration pourrait également conduire à la rupture de carbone sur la grille. Les grilles avec du carbone brisé apparaîtraient vides au microscope, comme si aucune tache ou échantillon n'était présent (Fig. 4E, à gauche). Une autre cause de rupture de carbone pourrait être due à l'utilisation de vieilles grilles, car le carbone devient plus fragile avec le temps. Le charbon pourrait également être devenu cassant s'il avait été traité plusieurs fois dans une unité à décharge luminescente ou pendant une très longue incubation. Dans ces cas, il peut être nécessaire d'acquérir de nouvelles grilles. Une manipulation brutale de la grille peut conduire à la rupture du carbone. Dans ce cas, l'utilisation de grilles qui ont un support en plastique formvar avec du carbone peut être bénéfique. Si la grille semble avoir des taches de particules irrégulières au microscope, c'est peut-être parce que la grille a séché pendant la préparation. Il est essentiel de maintenir la grille hydratée tout au long de la procédure de coloration immunogold. Il peut être nécessaire d'augmenter la taille des gouttelettes de liquides sur Parafilm ou d'effectuer toutes les étapes dans une chambre humidifiée (Fig. 1). Les grilles inégales pourraient également être causées par des interactions entre le tampon et la solution de coloration négative (Fig. 4F). Le PTA interagit avec les tampons phosphate pour produire des artefacts de type fractal, tandis que l'UA interagit avec les tampons phosphate pour créer des artefacts cristallins. Dans ce cas, des étapes de lavage supplémentaires avec de l'eau distillée peuvent être nécessaires avant d'appliquer la solution de coloration négative sur les grilles.

Comprendre les résultats

Analyses statistiques

Le marquage à l'immunogold de suspensions de particules virales est souvent interprété par des moyens qualitatifs et visuels. Des analyses statistiques, telles que le calcul et l'analyse du nombre d'étiquettes d'or associées à une particule spécifique, peuvent être effectuées mais dépendent de l'échantillon étudié et sortent donc du cadre de cet article. Cependant, ce faisant, il est important de garder à l'esprit que les anticorps peuvent ne pas se lier complètement à l'antigène d'intérêt ou que tous les anticorps primaires ne seront pas liés par un anticorps secondaire conjugué à l'or colloïdal, car ceux-ci dépendront de l'encombrement stérique, concentrations d'anticorps et taux de liaison. Toute quantification effectuée doit également prendre en considération la quantité de marquage de fond qui apparaît lorsque des marqueurs en or colloïdal sont trouvés sur le film de support sans particules virales présentes. Le rapport des marqueurs à l'or spécifiquement liés aux non spécifiquement liés est important pour estimer l'erreur d'une expérience de marquage à l'or immunologique. Pour calculer le rapport, collectez plusieurs micrographies TEM au grossissement souhaité et déterminez un nombre moyen de particules d'or colloïdales non spécifiques sur toutes les micrographies. Comparez cela au nombre d'or colloïdaux liés à l'antigène. Un rapport acceptable pour la spécificité de liaison lors du marquage à l'or immunologique serait d'au moins 10:1, sinon des interprétations erronées du marquage sont probables.

Résultats typiques

Les antigènes d'intérêt peuvent être identifiés à l'aide de marqueurs en or colloïdal après des méthodes de microscopie immunoélectronique. Les figures fournissent des exemples de marquage réussi des glycoprotéines de l'hémagglutinine, à la fois sur l'échantillon de vaccin antigrippal Flublok (Sanofi Pasteur) disponible dans le commerce (Fig. 2) et sur le virus vivant de la grippe A H1N1 (Fig. 3). Les étiquettes Immunogold délimitent les bords des deux échantillons, car les glycoprotéines dépassent à l'extérieur des deux échantillons avec un étiquetage de fond minimal. Cela contraste fortement avec la microscopie à coloration négative des mêmes échantillons, qui affiche la morphologie des échantillons de virus et de vaccins sans marqueurs en or colloïdal. Notez que le fond de l'échantillon marqué à l'or immunologique semble être entièrement recouvert de protéines, par rapport au fond de carbone pur de l'échantillon qui est simplement coloré négativement. En effet, le blocage avec la BSA entraîne un dépôt d'albumine non spécifique sur la grille, qui peut être visualisé en arrière-plan mais n'interfère pas avec le marquage.

Considérations de temps

La coloration Immunogold nécessite plusieurs heures en raison des nombreuses longues incubations et de la manipulation soigneuse et répétée de la grille. Il est donc recommandé de faire plusieurs grilles en parallèle pour maximiser le coût en temps, car la préparation de grilles supplémentaires n'allonge pas significativement le temps nécessaire. Les auteurs recommandent de toujours effectuer une coloration négative TEM sur tous les échantillons avant de commencer les protocoles de coloration immunogold, car la coloration négative peut être effectuée relativement rapidement et peut être effectuée pour garantir que les conditions de l'échantillon sont optimisées pour la coloration immunogold.

Remerciements

Ce travail a été soutenu par le programme de recherche intra-muros de l'Institut national des allergies et des maladies infectieuses, des Instituts nationaux de la santé et de la Biomedical Advanced Research and Development Authority.


Résultats

Caractérisation phénotypique des iMSC et adMSC

L'iMSC et l'adMSC ont tous deux été évalués pour les caractéristiques et les critères d'identification des MSC, tels qu'établis par l'International Society for Cellular Therapy 46 . L'analyse par cytométrie en flux a révélé une expression élevée des marqueurs MSC, notamment Sca-1, CD29, CD44, CD73 et CD106. En revanche, il n'y avait aucune expression de marqueurs leucocytaires, y compris CD45, CD11b et CD31 (Fig. 1A). Nous avons constaté que, tandis que adMSC exprimait fortement le CD90, les iMSC étaient négatifs pour l'expression du CD90. Les deux types cellulaires étaient positifs pour l'expression de CD106, qui était exprimé exclusivement sur MSC et non sur des fibroblastes cutanés (non montré). Des études de différenciation à trois lignées ont également révélé que l'adMSC et l'iMSC pouvaient être différenciés en adipocytes, ostéoblastes et chondrocytes (Fig. 1B).

Caractérisation phénotypique des iMSC et adMSC. (UNE): Expression des déterminants de la surface cellulaire par cytométrie en flux. Coloration d'anticorps spécifique représentée en rouge, tandis que la coloration de contrôle isotypique pour chacun s'affiche en bleu. Le pourcentage de la coloration positive pour chaque marqueur a été indiqué. (B): Différenciation en trois lignées du passage 3 MSC, comme décrit dans la section « Matériels et méthodes ». Adipocytes detected using Oil Red O (×200) chondrogenesis by Alcian Blue, and osteogenesis by Alizarin Red staining at day 12 after differentiation. Abbreviations: adMSC, adipose-derived mesenchymal stem cell iMSC, iPSC-derived mesenchymal stem cells.

Effects of MSC Administration on Clinical Signs and Colonic Lesions in Mice with DSS-Induced Colitis

Mice treated with DSS in their drinking water exhibited clinical signs consistent with colitis, including sustained weight loss, bloody diarrhea and abnormal fecal consistency resulting in decreased clinical scores over time (Fig. 2). Following the onset of signs of colitis, mice (m = 5 per treatment group) were treated with MSC (1 × 10 6 MSC per mouse per injection, i.v.) on days 10, 13, and 16. In mice treated with either iMSC or adMSC the clinical illness scores were significantly reduced compared to mice treated with DSS only (for iMSC-treated mice, p = .003 and for adMSC treated mice, p = .001 respectively) (Fig. 2A). The improvement in clinical scores became apparent within 1 day of the first MSC injection and was maintained during the period of MSC injections, whereas clinical scores continued to worsen in DSS-only treated animals.

Effects of mesenchymal stem cells (MSC) administration on clinical scores and inflammatory score in DSS-induced colitis mice. Mice were monitored for percentage of weight loss, fecal occult blood, and fecal consistency every day during DSS treatment period (19 days) and a total clinical score was calculated. (UNE): Clinical score over time in 4 groups of mice (m = 5 per group): control, DSS treated + PBS DSS + iMSC, and DSS + adMSC. MSC were administered by tail vein on days 10, 13, and 16. (B): Histology of colonic tissue sections from one mouse from each of 4 treatment groups, based on H&E stained sections. (C): Quantitative inflammatory scores assessed by H&E histopathology, as described in “Materials and Methods” section. Data was transformed to a normal distribution and the statistical differences were calculated using (A) repeated measures One-way ANOVA with Tukey's adjustment, (B) One-way ANOVA with Tukey's adjustment (*, p ≤ .05 **, p ≤ .01 ***, p ≤ .001 ****, p ≤ .0001). Scale bar indicated 50 µm. Abbreviations: adMSC, adipose-derived mesenchymal stem cell DSS, dextran sodium sulfate iMSC, iPSC-derived mesenchymal stem cells inj, injection ns, not significant PBS, phosphate-buffered saline.

Gross lesion scores and histopathology were evaluated in distal colon tissues collected in mice euthanized at 72 hours after the third MSC injection (day 19 of DSS treatment). In mice treated with DSS only (compared to untreated control animals), the colon appeared shortened and hyperemic (data not shown). Histologically, colonic tissues from DSS-treated mice exhibited severe infiltration of inflammatory cells, variable degrees of colonic gland ectasia and necrosis, extensive mucosal erosion to ulceration, and occasional complete loss and collapse of mucosal architecture (Fig. 2B) consistent with previous studies 42, 44, 47 . In contrast, colonic tissues from mice treated with either iMSC or adMSC exhibited an overall reduction in transmural inflammation, with significantly less infiltration of inflammatory cells in the lamina propria, diminished mucosal ulceration, and decreased mucosal collapse and granulation tissue formation. The overall histological inflammatory scores were significantly improved in mice treated with either iMSC or adMSC, compared to the PBS-treated group (iMSC, p = .002 adMSC, p = .003) (Fig. 2C). These results indicated therefore that iMSC were equivalent to adMSC in their ability to ameliorate the signs of intestinal inflammation induced by DSS treatment in this model of IBD.

Trafficking of MSC to Intestinal and Extraintestinal Tissues

To investigate the distribution of MSCs to sites of colonic inflammation, MSC were labeled using DiR dye immediately prior to injection. Cell distribution was monitored using IVIS live animal imaging. These studies revealed that labeled MSCs were primarily distributed to lungs initially, and at later time points labeled MSC could also be localized in the liver and spleen (Fig. 3A). However, labeled cells could not be detected by IVIS imaging in intestinal tissues.

Localization of labeled mesenchymal stem cells (MSC) in live animals and tissue sections. (UNE): For in vivo localization, MSCs were labeled using DiR dye before injection and mice were monitored by IVIS in vivo fluorescent imaging at 24 hours after the first injection, 72 hours post-injections and on the day of euthanasia. High concentrations of MSC were found in lung and liver and spleen, but not in intestinal tissues. (B): In vitro labeled MSC using fluorescent labeled (DiD). Localization of labeled MSCs in colonic mucosa and regional lymphoid tissues, tissues were collected 10 days after MSC administration. (C): Presence of labeled MSCs in spleen and mesenteric lymph node tissues. (RÉ): Labeled MSC in colonic mucosa (arrow) presented in corresponding channel. (E): High power views of labeled MSC in colonic mucosa and submucosa. (F, G): Labeled MSC in Peyer's patch of colon (arrow). Scale bar indicated 50 µm in all panels except panel (B) (indicated 25 µm). Abbreviations: adMSC, adipose-derived mesenchymal stem cell Ctrl, control DSS, dextran sodium sulfate hrs, hours iMSC, iPSC-derived mesenchymal stem cells MLN, mesenteric lymph node PBS, phosphate-buffered saline.

To increase the sensitivity of cell detection, additional studies were done with mice injected with DiD-labeled MSC (Fig. 3B), followed by immunohistochemical examination of tissues from injected mice (Fig. 3C–3G). These studies revealed that labeled MSC could be detected only very rarely in the colonic mucosa and submucosa (Fig. 3D, 3E), in Peyer's patches (Fig. 3F, 3G) and mesenteric lymph nodes (Fig. 3C) of treated animals. In contrast, labeled MSC were much more numerous in the spleen (Fig. 3C) and lung tissues (data not shown). The relatively scarcity of MSC in colonic tissues following i.v. injection in DSS models is consistent with several previous studies 13, 22, 48, 49 , but differs markedly from findings in other published studies in which high numbers of labeled MSC were found in intestinal tissues 23, 50, 51 . Our findings, with very low numbers of MSC in colonic tissues, suggest that the therapeutic benefits of injected MSC were more likely to have been mediated by paracrine secreted factors than by direct cell-to-cell effects between MSC and colonic epithelial cells.

Effects of MSC Administration on Epithelial Regeneration

The histologic appearance of colonic tissue from mice treated with MSC demonstrated remarkable recovery of intestinal epithelial integrity (see Fig. 2B). These findings suggested therefore that MSC treatment may have affected directly the reconstitution of epithelial integrity in the colon. Stimulation of epithelial regeneration could be mediated by several factors, including enhanced neovascularization, increased intestinal stem cell regeneration, and greater crypt cell proliferation and differentiation 52, 53 . Therefore, immunohistochemistry was used to investigate these processes in colonic tissues of DSS-treated control mice and mice treated with iMSC and adMSC (Fig. 4).

Effects of mesenchymal stem cells (MSC) administration on intestinal epithelial cell proliferation, stem cell recruitment, and angiogenesis. (UNE): Immunoflourescence detection of Ki-67+ (red) cytokeratin+ (green) intestinal epithelial cells in colonic tissues from mice with DSS-induced colitis, with or without MSC treatment. (B): Graphical representation of numbers of Ki-67+ epithelial cells/5 villi. (C): Immunofluorescence detection of Lgr5+ intestinal stem cells (red) at the base of colon crypts in colonic tissues from control and MSC-treated mice. (RÉ): Graphical representation of numbers of Lgr5+ stem cells per mm 2 tissue. (E): Immunofluorescence detection of CD31+ neoangiogenic cells in colonic tissues of control and MSC treated mice. (F): Graphical representation of the mean vessel density and mean vessel area/mm 2 of mucosa, as determined as described in “Materials and Methods” section. The statistics reported as mean ± SD, statistical differences were calculated using One-way ANOVA with Tukey's adjustment (*, p ≤ .05 **, p ≤ .01 ***, p ≤ .001 ****, p ≤ .0001). Scale bar indicated 50 µm in all panels. Abbreviations: adMSC, adipose-derived mesenchymal stem cell CKs, cytokeratin DAPI, 4′,6-diamidino-2-phenylindole DSS, dextran sodium sulfate iMSC, iPSC-derived mesenchymal stem cells Lgr5, leucine rich repeat containing G protein-coupled receptor 5 ns, not significant PBS, phosphate-buffered saline.

First, we observed a significant increase in the numbers of Ki-67+ intestinal epithelial cells in the colon of mice treated with iMSC and with adMSC, compared to the numbers of Ki-67+ epithelial cells in DSS-only treated animals and in untreated control animals (Fig. 4A, 4B). In addition, we found that the numbers of Lgr5+ intestinal stem cells were significantly greater in the colonic mucosa of animals treated with MSC, compared to DSS-only treated or control animals (Fig. 4C, 4D). Finally, MSC-treated animals demonstrated increased angiogenesis as determined by significantly increased numbers of CD31+ endothelial cells, as well as increased mean vessel density and area compared to control animals, (Fig. 4E, 4F).

Taken together, these findings indicate that systemic administration of iMSC or adMSC exerted an important trophic effect on intestinal epithelial cells, by stimulating proliferation and recruitment of intestinal stem cells, and on the overall intestinal blood supply, by stimulating local angiogenesis. Thus, these findings suggest secretion of multiple trophic factors by i.v. delivered MSC. The stem cell tracking data, and the paucity of MSC detected in colonic tissues, strongly suggests that these trophic factors were likely to have been produced at sites distant from the GI tract.

Administration of MSC Reverses Microbiome Dysbiosis

Previous studies have found that DSS-induced colitis causes alterations in the gut microbiome 54 . In our studies, we used 16S sequencing to investigate the composition of the gut microbiome of DSS-treated animals, and we also found marked alterations in the populations of several important gut phyla (Fig. 5). For example, we observed a significant relative increase in Protéobactéries (Fig. 5A), along with increased Bactéroïdes, and decreased Firmicutes in mice treated with DSS, compared to untreated control animals (Fig. 5D). Overall, the DSS alone group had the least microbial community diversity measured within a sample as showed in an alpha diversity graph (using Simpson index) (Fig. 5B). Also, as shown in the Venn diagram (Fig 5E) the iMSC and adMSC treated groups shared more OTUs (operational taxonomic units) with the healthy group compared to the DSS only group.

Effects of mesenchymal stem cells (MSC) administration on gut microbiome. Fecal pellets were collected at 2 days after the last MSC injection from control and MSC-treated animals (m = 5 per group) and analyzed by 16s rRNA sequencing as determined as described in “Materials and Methods” section. (UNE): Relative abundance of Proteobacteria presented in each treatment group. (B): Microbial diversity within treatment groups (Simpson alpha diversity index) calculated with QIIME (Version 1.7.0). (C): Comparative analysis of differences between treatment groups (beta diversity), heat map represents average differences, with 0 as no difference, 0.3 is maximum differences. Scale bar shown in bottom left. (RÉ): Relative abundance of top 10 phyla presented in each treatment group. (E): Venn diagram generated according to the Operational Taxonomic Unit clustering of each treatment group, each number represents number of bacterial species, either shared or unique to treatment groups. The statistics reported as mean ± SD, statistical differences were calculated using One-way ANOVA with Tukey's adjustment (*, p ≤ .05 **, p ≤ .01 ***, p ≤ .001 ****, p ≤ .0001). Abbreviations: adMSC, adipose-derived mesenchymal stem cell DSS, dextran sodium sulfate iMSC, iPSC-derived mesenchymal stem cells.

Notably, in mice treated with either iMSC or adMSC, after 10 days of stem cell treatment, and despite the continued administration of DSS, the composition of the microbiome in these animals had returned to a population that much more closely resembled that of the microbiome of healthy untreated mice (Fig. 5C). For example, the iMSC-treated group of animals had the most similar taxa distribution relative to heathy control animals, compared to DSS only animals or DSS animals treated with adMSC (Fig. 5D). These results suggest that treatment with MSC helped restore the normal colonic flora, although the exact mechanism of the effect remained undetermined.

Effects of MSC Administration on Intestinal Inflammation

The effects of MSC injection on inflammatory responses in the colon and regional lymphoid tissues were examined next. In colonic tissues of DSS-treated animals, increased infiltrates of F4/80+ and CD11b+ macrophages, CD3+, CD4+ T cells, and CD103+ inflammatory monocytes were observed, compared to colonic tissues of healthy untreated animals.

In animals treated with MSC, the numbers of macrophages and monocytes were significantly reduced compared to DSS only treated animals treated (Fig. 6A). FOXP3+ regulatory T cells were significantly more numerous in colonic tissues of mice treated with either iMSC or adMSC, compared to control animals or DSS-only animals (Fig. 6A). These results are consistent with the results of previous studies 13, 22 and suggest that MSC treatment ameliorated colonic inflammation, as reflected by increased numbers of regulatory T cells and reduced macrophage and neutrophil infiltration into colonic submucosa. However, MSC treatment in our model did not alter the numbers of infiltrating T cells in colonic tissues (Fig. 6A).

Effects of mesenchymal stem cells administration on colonic inflammation. Tissue sections were immunostained with the indicated antibodies, as noted in “Materials and Methods” section, and imaged using a confocal microscope. Quantitative image analysis was used to quantitate the density of inflammatory cells (see “Materials and Methods” section). (UNE): Distribution of FOXP3, F4/80, CD11b, CD3, CD4 T cell, and CD103+ cells in colonic tissues. (B): Leukocyte populations in spleen and mesenteric lymph node tissues as assessed by flow cytometry (see “Materials and Methods” section). Statistical differences were calculated using One-way ANOVA with Dunnett multiple comparison to DSS treated group (*, p ≤ .05 **, p ≤ .01 ***, p ≤ .001 ****, p ≤ .0001). Abbreviations: adMSC, adipose-derived mesenchymal stem cell DAPI, 4′,6-diamidino-2-phenylindole DSS, dextran sodium sulfate FOXP3, Foxhead Box P3 iMSC, iPSC-derived mesenchymal stem cells MLN, mesenteric lymph node Tc, cytotoxic T cell Th, T helper cell Treg, regulatory T cell.

Notably, iMSC and adMSC were comparable in their effects on reducing the severity of colonic inflammation. However, there were no consistent changes in T cell or B cell or myeloid cell populations in the spleen or mesenteric lymph node tissues of animals treated with MSC, compared to animals with DSS-induced colitis (Fig. 6B). Thus, overall administration of MSC reduced local colonic inflammation, in addition to stimulating epithelial cell proliferation and angiogenesis, but had little effect on immune cell populations in extraintestinal tissues.


Trouble shooting advice

Low quality DNA/low yield. There are several possible causes for low yield/quality DNA. The most common reasons include inappropriate storage of sample following collection, non optimal starting amount (too much or too little) of sample collected, and insufficient cell lysis. Suggestion: Reisolate DNA from starting material.

Low/no amplification in PCR (positive controls and standards). There are several possible causing for low/no PCR amplification. Suggestion: Check primer dilutions, you may need to set up fresh working dilutions of primers from oligomer stock.

Polymerase not working efficiently. Suggestion: Check PCR cycling to ensure appropriate activation of DNA polymerase is in place select new aliquot of master mix and repeat PCR.

Fluorescent dye not working. Suggestion: Check PCR machine setting to ensure appropriate detection method for SYBR Green is selected select new aliquot of master mix and repeat PCR.

Low/no amplification in PCR (samples).

low quality DNA (see above)

too much/too little DNA used (see Variation in Copy Number for expected results and modify accordingly)

Amplification in NTC. It is important that you determine the cause of this amplification results from plates with NTC amplification should not be used. Suggestion: First check dissociation curve plot to determine likely causes of amplification in NTC gDNA contamination or primer dimer formation. If cause of amplification in NTC is contamination (usually in the PCR set-up) change water and repeat NTC. Primer dimer formation is another cause of signal in the NTC wells. This amplification can be identified via examination of the dissociation curve primer dimmer dissociation curves will appear very different to telomere dissociation profiles.


Texte SI

Expanded Multipressure Hydrodynamic Analysis.

In addition to the experiments examining hydrodynamics of cell/cluster transit at 33-cm H2O pressure in the main text (Fig. 3 B et C), MDA-MB-231 L2 GFP cells were also transited at 83 cm H2O through 5- and 7-µm constrictions for analysis. Cells transiting through 10-µm constrictions under the higher pressure traveled too quickly for accurate analysis using our camera and were not included in this analysis. The dimensionless number, transcapillary conductance (Tc) (derived below), represents the ease at which events are able to traverse a given constriction (higher is greater ease). Tc permits the comparison of the transiting behavior of cells at the different pressures. Single cells transiting at both pressures are plotted in Fig. S2UNE, demonstrating agreement between the transit behaviors at the different pressures using Tc (Fig. S4). In Fig. S2 B–D, clusters were plotted alongside single-cell data assuming that clusters behaved as (je) cohesive resistive units (total volumes summed), (ii) the largest cell within a given cluster, and (iii) individual cells in series (resistances of constituent cells summed), respectively. Similar to Fig. 3C, clusters plotted as cohesive resistive units (Fig. S2B) overestimated predicted transit conductances. When clusters were plotted as individual cells in series (Fig. S2), cluster transit most closely matched single-cell data. Plotted as the largest constituent cell (Fig. S2C), clusters underestimated predicted transit conductances. This underestimation is due to numerous cluster events containing high numbers of cells transiting through 7-µm channels at 83 cm H2O (Fig. S3), which skewed the dataset. In the 33-cm H2O pressure case (Fig. 3C), total cluster resistance could be appropriately reduced to the largest cell within the cluster because conductance was highly sensitive to small differences in the sizes of individual cells (Fig. S7). This assumption does not hold true for cases in clusters that contain large numbers of cells with similar sizes. Therefore, in the generalized case, cluster hydrodynamics appears to be most accurately modeled as individual cells transiting in series.

Posttransit Cluster Reorganization and Proliferation.

To study whether the transit process affected the viabilities and proliferative abilities of CTC clusters, cancer cell (Fig. S5) and cultured CTC clusters (Fig. 4UNE) were observed exiting 7-µm capillary constrictions transiting under 33 cm H2O. Individual cells within CTC clusters rapidly contracted from elongated to rounded morphologies within ∼10–30 s of exiting constrictions (Fig. 4UNE), and CTC clusters did not experience catastrophic membrane integrity failure during transit as determined by fluorescent dye localization (Fig. 2 UNE, , et F, and 4UNE, Fig. S5, and Movies S2, S3, S8, and S12). Clusters rapidly reformed within into “typical” circular cluster-like morphologies with numerous intercellular adhesions between multiple cells (Fig. S5C). MDA-MB-231-LM2-GFP and LNCaP clusters that traversed constrictions were collected, seeded into fresh media, incubated, and observed over 7 d (Fig. S6). Compared with untreated controls, transited clusters exhibited indistinguishable rates of adhesion and proliferation. The morphologies of transited clusters were also indistinguishable from untreated clusters 1 h after seeding.

Characterization of RBC Transit Morphologies.

The discocytic shapes of RBCs are known to deform in response to the parabolic pressure profiles within capillaries (46). The morphologies of RBCs transiting through engineered capillary constrictions were examined to determine how closely blood cell shapes matched in vivo observations. RBCs transiting under 20-cm H2O pressure, assumed “parachute-like” morphologies in 7-µm constrictions (Movie S1) and “torpedo-like” morphologies in 5-µm constrictions (Movie S2). These shapes were indistinguishable from the shapes of RBCs transiting through 7- and 4-µm-diameter capillaries (46), respectively. This suggests that engineered capillary constrictions were relevant models of the hydrodynamic fluid environment within true capillaries.

Scaling Analysis and Transcapillary Conductance Derivation.

What follows is a highly simplified model of the transit of cells through capillaries. The aim was not to derive an exact law, but to use some simplifications and dimensional arguments to discover important parameters and restrict the functional form of the experimental data.

The model problem was of an elastic spherical cell of radius R forced through a cylindrical capillary of radius r by an applied pressure difference ΔP. The objective was to determine velocity, U, once the cell has fully entered the capillary. Fig. S10UNE is a definition sketch used for the scaling analysis.

The suspending liquid was taken as a Newtonian fluid with properties similar to water. The scale of the resulting fluid motion was in the regime where the Reynolds number is very small. Because this dimensionless parameter was small, fluid density could be ignored and dynamic viscosity, µ, was the defining fluid parameter (47).

The overall mechanical responses of cells are typically viscoelastic (32). The elastic component of the internal stress of the cell was determined by the instantaneous deformed state whereas the viscous component of the stress was determined by the history of deformation. Cells fully in the constriction transiting at constant velocity were experimentally observed to not further deform. The viscous component of the cell’s mechanical model was therefore assumed to be negligible (in the limit of long channels) when determining the steady transit velocity. The effective elastic modulus, E, was assumed to be the dominant mechanical property. The true mechanical at such large deformations certainly did not follow that of a linearly elastic solid of constant modulus.

In dimensional terms, the steady-state velocity was assumed a function of five parameters: U = f ( R , r , Δ P , μ , E ) , where F is an unknown function, and the exact nature of the elastic modulus is unknown.

Deformation.

Before entering the constriction the spherical cell had total volume, V, given as follows: V = 4 3 π R 3 . Once forced inside the capillary, we assumed that the deformed shape of the cell could be approximated as a cylinder of length L, with a spherical cap of radius r on both ends (Fig. S10UNE). The volume of this deformed shape was as follows: V = 4 3 π r 3 + π r 2 L . Because cell volume was assumed to be conserved, the dimensionless length of the cylindrical section of the deformed cell was as follows: L r = 4 3 R 3 − r 3 r 3 . From experimental images, this approximation of the true cell shape appeared reasonable (Figs. 1C et 2UNE). Even if the shape was not precise, the deformation field could be described by a single dimensionless geometric parameter, R/r, the relative size of the cell to the capillary.

Mechanical stress.

The average stress in the cell (??) was a function of the deformation field and the material property (E). Because the cell was not necessarily a linearly elastic solid, the elastic modulus can be a function of the deformation itself, namely E(R/r). In dimensionless terms, the average stress must follow a form, σ E 0 = ɛ ( E E 0 , R r ) , Where ɛ is an unknown function which depends upon the details of the deformation of the cell and E0 is the small strain constant elastic modulus. La fonction ɛ incorporates effects due to large deformation or nonlinear elasticity. It is conceivable that the functional form of ɛ may be very different for different types of cells. Although the function ɛ is very difficult to know, the argument here is that, when the deformed shape is constant, ??/E0 is only a function of R/r for a given cell type. In the limit of small deformations, the function ɛ would become the strain.

Fluid lubrication.

As the cell traversed the capillary, we assumed that a thin lubricating fluid layer of thickness, h, was present between the elongated cell and the capillary wall. The viscous shear stress, τ acting on the cell from this lubricating fluid layer was given by classic solution for Couette flow (47): τ = U μ h , where µ is the dynamic viscosity. The total shear force, T, is the stress multiplied by the total area over which it acts, T = 2πrμUL h . In using this model for the viscous stress, we assume the following:

h is a constant across the length of the cylindrical section, or h is an appropriately averaged value.

h « r, the model approximates two sliding parallel plates and do not need to account for the curvature around the capillary.

• Any leak back flow due to the pressure difference from one end of cell to the other is small in terms of the additional viscous stress (47).

When the deformed cell was moving at constant speed, the total shear force must balance the force due to applied pressure, ΔP, across the cell, Δ P π r 2 = 2 π r L μ U h . Rearranging for velocity, U = Δ Pr h 2 μ L . La valeur de h is unknown and must come from the coupling of the fluid and cell mechanics problem. Although the true value is complex, the order of magnitude of h can be estimated using results from fluid lubrication theory (47). A classic problem in lubrication theory is the slider bearing, where a block slides over a solid surface with a thin fluid gap. The gap height varies linearly over the length of the block. When the block slides at constant speed, the pressure inside the fluid layer increases dramatically and provides a lift force on the block. The excess pressure Pex inside a thin fluid layer can get very high. Although the detailed calculation of the pressure inside the lubrication layer requires knowing the variation in h and thus the shape of the cell in the capillary, the excess pressure in a lubrication layer can be estimated to be on the order of magnitude of the following: P ex ∼ μ U L h 2 . This scaling estimate is similar to a more complete analysis of classic problems for flow of red cells in capillaries (48).

Coupled flow and cell mechanics.

In the coupled problem of cell mechanics and fluid lubrication, the local pressure in the fluid gap must match the local stress of the deformed cell along the length of the cell. We can estimate the scaling of this force balance by equating the average stress and the excess pressure, σ ∼ P ex → ɛ E 0 ∼ μ U L h 2 . Solving for the gap thickness, h 2 ∼ μ U L ɛ E 0 . Combining this expression for the gap height with our expression for cell velocity, we obtain the following: U ∼ Δ P 2 r 2 4 ɛ E 0 μ L , which can be written as follows: U E 0 μ Δ P 2 r ∼ 1 4 ɛ L r . Importantly, everything on the right-hand side of the above equation is a function of R/r seul.

Although the function ɛ(R/r) is difficult to know, the magnitude of the strain must provide some measure of right order of magnitude. The end-to-end length of the deformed cell is L + 2r compared with the initial length of 2R. The strain is approximated as follows: ɛ ∼ 2 r + L − 2 R 2 R = 2 R 2 3 r 2 + r 3 R − 1. The true strain for a deformed sphere is a more complicated field, but the above expression is appropriate for an order of magnitude estimate.

Substituting in the expressions for ɛ and our previous expression for L/r and we obtain a dimensionless number we define as transcapillary conductance (Tc): T c = U E μ Δ P 2 d ∼ 1 4 ( 2 R 2 3 r 2 + r 3 R − 1 ) ( 4 3 ( R 3 r 3 − 1 ) ) , which for large values of R/r yields a power law for velocity scaling as (R/r) −5 .

The utility of the above model is not as an exact result, but indicates the scaling law and provides some guidance for plotting the experimental data in dimensionless terms. The model indicates that, for a given fluid, pressure drop, and cell type, Tc can be plotted as a function of the dimensionless cell size R/r (ou D/d), T c = U E μ Δ P 2 d . The scaling model points to a few important predictions about the cell velocity, namely, the following:

• Velocity depends strongly on R/r. A power law in the range of (R/r) −5 could reasonably be expected. Stronger dependencies could certainly occur when one considers uncertainty of the mechanics of cells under large deformations.

• Velocity scales as the square of the pressure difference.

• Velocity is inversely proportional to the fluid viscosity and elasticity of the cell i.e., a stiffer cell or more viscous fluid leads to lower velocities.

Finally, we should note that the above analysis assumed that the cell was transiting through a cylindrical tube, whereas in the experiments the cross section of the tube is square. Although we would expect the square shape to influence the details, we do not expect the square channel to change the basic scaling and dimensional analyses presented here. Furthermore, experimental and theoretical data have demonstrated that there are only small differences between pressure signatures CTCs transiting through square and circular cross-section channels (49).

Derivation of Unconstrained Spherical Volumes.

Images of the cell before entrance into the constriction were used to calculate unconstrained cell diameters. Within the entrance region of the devices, cells were constrained in the z axis (vertical) but unconstrained in the X et oui axes. Cells/nuclei were assumed to form a cylindrical shape with a “bulge” consisting of a sphere revolved around a radius R′ (Fig. S10B). The radius of the half-sphere, une, was taken as one-half of the channel height, H. From above, cells appeared as disks of apparent radii Γ = R′ + a.

The area of a slice in the z plane is as follows: A = π ( R ′ + x ) 2 = π ( R ′ 2 + 2 R ′ x + x 2 ) . Parce que X = (une 2 – z 2 ) 1/2 , A ( z ) = π ( R ′ 2 + 2 R ′ a 2 − z 2 + a 2 − z 2 ) . The total volume is as follows: V = ∫ − a a A ( z ) d z = π ∫ − a a ( R ′ 2 + 2 R ′ a 2 − z 2 + a 2 − z 2 ) d z . The first term of the integral simplifies to the following: π ∫ − a a R ′ 2 d z = 2 π R ′ 2 a , which is the volume of the inner solid cylinder of radius R′. The second term in the integral is as follows: π ∫ − a a 2 R ′ a 2 − z 2 d z = π 2 R ′ a 2 . The third term is as follows: π ∫ − a a a 2 − z 2 d z = 4 3 π a 3 . Therefore, the total volume is as follows: V = 2 π R ′ 2 a + π 2 R ′ a 2 + 4 3 π a 3 = 2 π R ′ 2 a ( 1 + π a 2 R ′ + 2 a 2 3 R ′ 2 ) . Note that, if cells/nuclei were simply assumed to take squished cylinder geometries, the computed volumes not have noticeable differences when a/R′ « 1. Experimentally, we measured Γ from the images of the cell in the entrance region and used the known value of une to estimate the cell volumes.


Résultats et discussion

We have described three methods for isolating guard cell protoplasts from A. thaliana at small and large scales. Une fois que A. thaliana GCPs are produced, they can be used for dissecting specific stomatal functions that can be investigated using a diversity of assays, such as electrophysiology, biochemistry of signal transduction, and expression profiling of guard cell-expressed genes.

Figure 1a–c shows various stages in the production of A. thaliana GCPs. Figure 1d,f illustrates the high quality of the protoplasts obtained these are round, with intact, evenly distributed chloroplasts. Figure 1d,e illustrates the purity of final large-scale preparations of GCPs and MCPs. Fluorescein dicctate (FDA) staining of the protoplasts obtained by either of the large-scale protocols shows 95% GCP viability. Although all of the results reported here were obtained with the WS ecotype, methods and yields of GCPs were also comparable for the Columbia (0) ecotype (data not shown).

We described two methods for the large-scale isolation of A. thaliana GCPs. The overnight method gives a significantly higher yield of GCPs than the same-day large-scale preparation. This protocol, yields approximately 5 million GCPs, providing approximately 30 µg of soluble and 10 µg of membrane protein we use a minimum of 10 µg protein per lane for Coomassie-stained SDS-PAGE protein gels (Fig. 2). It is possible that the longer the GCPs are exposed to the enzyme solution the greater the impact on the physiology of the protoplasts, although comparable results have been obtained for patch clamping studies using a rapid protoplasting protocol ( Wang et al., 2001 ) or an overnight protoplasting protocol ( Pei et al., 1997 ). Experimental determination of the optimal protoplasting method is suggested for a given assay.

The GCPs isolated by the same-day small-scale method yield ABA-regulated K + and anion currents (Fig. 3) comparable to those described by Pei et al. (1997 ), who used an overnight protoplasting protocol. A major advantage of A. thaliana over other species is the relative ease with which mutants can be identified by both forward and reverse genetic approaches. Schroeder and colleagues have used GCPs from A. thaliana mutants in ABA signaling such as abi1-1, abi2-1, era1, det3 et gca2 to assess resultant alterations in ion channel activity ( Pei et al., 1997, 1998, 2000 Allen et al., 1999, 2000 ). Recently, we have also described alterations in ABA signaling in G protein α subunit (gpa1) mutants ( Wang et al., 2001 ) and Szyroki et al. (2001 ) have described K + currents in a kat1 mutant.

ABA regulation of ion channels is achieved through complex and interwoven signal transduction pathways ( Leung & Giraudat, 1998 Munnik, 2001 ). In Fig. 4b,c we illustrate that, as previously shown for V. faba ( Jacob et al., 1999 ), ABA activates PLD activity in A. thaliana guard cells isolated by same-day large-scale method. It will be of interest to assay the available A. thaliana ABA-related mutants to determine which, if any, are altered in ABA activation of PLD.

Despite the large-scale protocols described here, the amount of GCP isolated is still limiting for RNA gel blot analysis of gene expression. Five million GCPs from the large-scale overnight approach typically yield only enough RNA for two or three lanes on a Northern blot. In contrast, sensitive RT-PCR approaches can provide an assessment of transcript levels starting with much smaller quantities of RNA. We described two RT-PCR-based methods for assessing relative gene expression levels in GCPs vs MCPs. The two approaches should and do yield qualitatively similar results, as illustrated in Fig. 5.

We had previously cloned the cDNA for an ABA-activated protein kinase (AAPK) from V. faba guard cells ( Li et al., 2000 ). Based on sequence analysis, the A. thaliana genome contains several possible AAPK orthologs. Figure 5a shows expression levels for one of these. Expression is significantly higher in GCPs than in MCPs, although there is some expression in the latter cell type, in contrast to V. faba where AAPK expression appears to be limited to guard cells ( Li et al., 2000 ). By contrast, a chloroplastic carbonic anhydrase ( Raines et al., 1992 ), which facilitates CO2–HCO3 − conversion, shows significantly lower expression in GCPs than in MCPs, consistent with the expectation from other plant species that GCPs have a limited photosynthetic capacity ( Goh et al., 1999 ). A comparable result was obtained in preliminary microarray analysis of GCP vs. MCP expressed genes, in which carbonic anhydrase and several other photosynthesis-related genes were observed to be expressed at higher levels in MCPs than in GCPs (S. Pandey and S. M. Assmann, unpubl. data). The RT-PCR of two characterized genes as ‘controls’ also validates our results. Amplification de la KAT1 gene which encodes an inward K + channel (as a guard cell-specific gene control) and actin genes (as a gene showing equal expression in all the cell types) clearly shows a greater abundance of KAT1 transcript in GCPs and approximately equal expression of actin genes in GCPs and MCPs. Such results demonstrate that modified, semiquantitative RT-PCR methods are an efficient method to compare expression profiles of GCPs and MCPs. Because such approaches are rapid, simple, use small quantities of RNA and are cost effective, they can be used in an initial survey of many genes. Once the candidate genes with interesting differences in the expression levels have been identified in this manner, one can proceed to more quantitative but expensive (in terms of reagents or labor) techniques such as real time RT-PCR ( Bustin, 2000 Szyroki et al., 2001 ), RNA gel blot and/or microarrays to elucidate the absolute quantitative difference in the expression levels.

Owing to the presence of mesophyll cells as contaminants and the extreme sensitivity of RT-PCR (compared with nonamplification hybridization techniques such as Northern blots) it is always advisable to compare the expression profile in both the cell types. If a RT-PCR product is observed at a lower cycle number or at a higher dilution in GCPs than in MCPs, then it is logical to conclude that the gene of interest is indeed expressed by the guard cells. One can also keep in mind that mesophyll contamination is a problem mostly with ‘amplification’ techniques such as PCR and RT-PCR, where very low quantities can be amplified to a significant level, whereas for techniques such as Northern blot or SDS-PAGE, where no amplification is involved, 1% MCP contamination does not contribute significantly to the results. Other contaminants, such as broken cell debris, do not contribute to the cDNA, as confirmed by observation of SYTO (Molecular Probes, Eugene, OR, USA) staining of nucleic acids only in intact protoplasts (data not shown). Staining was performed according to the manufacturer’s protocol.

In addition to the assays described above, A. thaliana GCPs have been used in fluorescence assays of cellular processes. Schreiber and colleagues have applied fluorescence transient analysis to assess guard cell photosynthesis ( Goh et al., 1999 ). Since fluorescent indicators for ions, lipids, and other signaling molecules continue to proliferate ( Gilroy, 1997 ), the potential for application to A. thaliana GCPs appears great. Although their small size renders A. thaliana GCPs less likely than GCPs from other species to be practical for assays of protoplast volume change in response to environmental signals, in all other respects, A. thaliana GCPs appear to be a highly useful addition to the plant physiologist’s toolkit.


Disclosure of Potential Conflicts of Interest

O.E.S., M.C., and K.-H.G. are cofounders and owners of Islet One AB, have uncompensated employment, and have compensated intellectual property rights and ownership interest. S.R. is a minority co-owner of Biolamina and has compensated intellectual property rights and ownership interest. J.S. is founder and co-owner of Exosome Diagnostics and has compensated employment, intellectual property rights, and ownership interest. C.R. and T.K. are compensated employees of Exosome Diagnostics. D.J.W. has compensated research funding from Athersys Inc. and United Therapuetics. The other authors indicated no potential conflicts of interest.

Remarque : L'éditeur n'est pas responsable du contenu ou de la fonctionnalité des informations fournies par les auteurs. Toute question (autre que le contenu manquant) doit être adressée à l'auteur correspondant à l'article.



Commentaires:

  1. Pax

    C'est une réponse remarquable, plutôt amusante

  2. Kisida

    Je vous recommande de rechercher google.com

  3. Meztitaur

    Laissez-le vous aider?

  4. Daunte

    Et puis, une personne est capable



Écrire un message