Informations

Vecteur promoteur de la luciférase sur vecteur p-AcGFP1-C1

Vecteur promoteur de la luciférase sur vecteur p-AcGFP1-C1


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Le vecteur AcGFP1 peut émettre de la lumière par lui-même, alors que dans le cas du vecteur Luc, un substrat est nécessaire pour la réaction. Néanmoins, Luc serait plus spécifique ou meilleur que AcGFP1. Pourquoi cela s'appelle-t-il ainsi ? Quels sont les avantages des vecteurs Luc par rapport à AcGFP1 ?


Vous confondez luminescence et fluorescence. GFP n'émet pas de lumière. L'abréviation signifie Green Fluorescent Protein. Vous devez lui faire briller une source de lumière bleue et elle deviendra verte fluorescente. Le problème est que de nombreux organismes ont une fluorescence de fond, une cellule sans GFP peut souvent avoir un peu de fluorescence par elle-même ou contenir des pigments qui masquent le signal.

Les dosages de luciférase dépendent d'une réaction chimique qui oxyde une molécule (luciférine dans le cas de la luciférase de luciole) et des photons sont émis. Ceci est beaucoup plus sensible que la fluorescence mais est également beaucoup plus cher et nécessite généralement (mais pas toujours) une lyse cellulaire. Il est très rare qu'une cellule émette de la lumière par elle-même, donc l'arrière-plan sera beaucoup plus bas, ce qui vous permettra de voir une plus petite différence.

Il existe de nombreuses raisons de choisir l'une plutôt que l'autre dans un essai, si vous partagez un peu plus sur la façon dont vous avez l'intention d'utiliser le rapporteur, vous pouvez obtenir une réponse plus détaillée.


Le vecteur à utiliser dépendra de ce que vous voulez faire.

Les problèmes possibles avec GFP sont :

  • La perte de fonction de la protéine de fusion (vous ajoutez 238 acides aminés à votre protéine, c'est un gros changement !). Il existe des vecteurs permettant la fusion en C- ou N-ter de votre protéine pour essayer d'éviter cela.

  • La GFP peut se séparer de sa protéine de fusion, rendant les observations ou les immunoprécipitations inutiles.

  • Avec un vecteur d'expression élevé, vous pouvez avoir une saturation de fluorescence dans vos cellules, donc la quantification serait difficile.

Avec le dosage de la luciférase, vous ajoutez le substrat afin que vos quantifications puissent être faites dès le début de la réaction et les luminomètres sont suffisamment sensibles pour détecter une activité Luc très faible ou utiliser très peu de cellules.

MAIS

Les vecteurs GFP vous permettent de faire des dosages in vivo (quantification, localisation intracellulaire, tri cellulaire…) tandis que les dosages Luc nécessitent la lyse de vos cellules. Ainsi, selon votre objectif, il sera préférable d'utiliser un système ou l'autre.


Développement d'un promoteur radio-induit d'importance thérapeutique

La radiothérapie génétique est une combinaison de radiothérapie et de thérapie génique qui peut résoudre certains des problèmes associés à la radiothérapie conventionnelle. Un promoteur sensible au rayonnement a été obtenu à partir d'une bibliothèque de promoteurs composée de fragments d'ADN créés en liant le signal de la boîte TATA à des séquences de liaison combinées de manière aléatoire de facteurs de transcription réactifs au rayonnement. Chaque promoteur connecté au gène de la luciférase a été évalué par l'amélioration de l'expression de la luciférase dans les cellules transfectées après irradiation aux rayons X. La réactivité du meilleur promoteur a été améliorée par l'introduction aléatoire de mutations ponctuelles et le promoteur résultant a montré une amélioration de plus de 20 fois de l'expression de la luciférase après irradiation aux rayons X à 10 Gy. L'expression des gènes en aval a également été améliorée dans les cellules transfectées de manière stable non seulement par les rayons X, mais également par l'irradiation par faisceau de protons et l'une ou l'autre amélioration a été atténuée lorsqu'un antioxydant a été ajouté, suggérant ainsi l'implication du stress oxydatif dans l'activation du promoteur. Des promoteurs construits ont également été activés dans des tumeurs cultivées chez des souris. De plus, la destruction cellulaire avec le gène fcy::fur (un gène suicide convertissant la 5-fluorocytosine en 5-fluorouracile hautement toxique) n'a augmenté de manière dose-dépendante avec la 5-fluorocytosine qu'après irradiation aux rayons X in vitro. Ces résultats suggèrent que les promoteurs obtenus par cette méthode pourraient être utilisés pour d'éventuelles applications cliniques.


Ingénierie du génome

Bien que surexprimer ou abattre un gène puisse vous en dire beaucoup sur sa fonction et/ou altérer l'activité cellulaire d'une manière intéressante d'un point de vue appliqué, il est parfois préférable de supprimer des gènes ou d'introduire de nouveaux gènes et mutations dans le génome bactérien lui-même. La manipulation directe du génome peut vous donner un contrôle plus subtil sur l'expression et l'activité des protéines, limitant ainsi l'utilisation des ressources cellulaires nécessaires à la production de grandes quantités de protéines ou de plasmides à nombre de copies élevé. Que vous étudiiez la biologie fondamentale d'un gène bactérien ou que vous réorientiez des voies métaboliques pour produire un composé thérapeutique, il existe de nombreuses façons différentes de modifier les génomes bactériens. Du recombineering au CRISPR, cette collection contient une variété d'outils pour vous aider à exploiter les génomes bactériens pour votre recherche.

Plasmide identifiant Technique PI But
pCas9 42876 CRISPR Luciano Marraffini Expression bactérienne de l'ARNg de la nucléase Cas9. Pour une liste plus complète de nos plasmides bactériens CRISPR, voir ici.
pwtCas9-bactéries 44250 CRISPR Stanley Qi Expression inductible par l'anhydrotétracycline de Cas9 de type sauvage de S. pyogenes pour induire des cassures double brin. Pour une liste plus complète de nos plasmides bactériens CRISPR, voir ici.
pgRNA-bactéries 44251 CRISPR Stanley Qi Expression d'ARN guide personnalisable (ARNg) pour la perturbation ou le knockdown des gènes bactériens. Pour une liste plus complète de nos plasmides bactériens CRISPR, voir ici.
Série pGRG Divers plasmides Transposition Tn7 Nancy Craig Un gène d'intérêt cloné dans l'un de ces plasmides peut être transposé dans le site de fixation attTn7 présent dans de nombreux génomes entérobactériens. Les bactéries d'intérêt sont transformées avec la construction appropriée, cultivées à la température permissive (32°C) pour permettre la transposition, et la construction est ensuite durcie par croissance à la température non permissive (42°C). La transposition est suffisamment efficace pour que la sélection ne soit pas requise.
pET-HIS-Sangamo 40786 TALEN Gang Bao Clonage de passerelle et expression d'un TALEN marqué en N-terminal fusionné à un E. coli domaine d'endonucléase FokI optimisé en codons.
pET-Sangamo-His 40787 TALEN Gang Bao Clonage de passerelle et expression d'un TALEN C-terminal marqué His fusionné à un E. coli domaine d'endonucléase FokI optimisé en codons.

Mesure de l'expression de la luciférase à l'aide du kit de test SpectraMax Glo Steady-Luc Reporter

L'utilisation de rapporteurs de gènes tels que la luciférase permet une surveillance très sensible et non destructive de l'expression des gènes. La luciférase de luciole, une protéine monomère de 61 kD, est particulièrement attrayante pour de nombreux chercheurs en raison de sa sensibilité élevée, de sa large plage de détection linéaire et de son bruit de fond extrêmement faible en raison de l'absence d'activité luminescente endogène dans les cellules de mammifères. Pour le dosage de plus en plus populaire utilisant des lecteurs de microplaques à luminescence, le dosage « glow » compatible à haut débit est souvent préféré pour le traitement par lots de plusieurs plaques. Dans cette note d'application, nous démontrons la mesure de l'expression de la luciférase dans les cellules CHO-K1 à l'aide du kit SpectraMax ® Glo Steady-Luc™ Reporter Assay, qui fournit des signaux de luminescence de longue durée. Ce kit de dosage est optimisé pour le lecteur de microplaques multimode SpectraMax ® i3x avec un protocole préconfiguré dans le logiciel SoftMax ® Pro pour une analyse rapide des données.

Matériaux

  • Kit de dosage SpectraMax Glo Steady-Luc Reporter, dispositifs moléculaires (kit explorateur #R8352 ou kit en vrac #R8353)
  • Kit concurrent : Système de dosage Steady-Glo Luciferase, Promega (Cat # E2510)
  • Lecteur de microplaques SpectraMax i3x, dispositifs moléculaires (Cat# i3X)
  • Plaques à fond transparent à paroi blanche à 96 puits, Costar (Cat # 3903)
  • Luciférase purifiée, Promega (Cat# E1701)
  • Plaques blanches solides à 384 puits, Greiner (Cat# 655075)
  • Cellules CHO-K1, ATCC (Cat# CCL-61)
  • Milieu de croissance complet
    • Ham’s F12 Medium, Life Technologies (Cat# 11765-54)
    • Sérum fœtal bovin, Gemini (Cat# 100-106)
    • Pénicilline/Streptomycine, Life Technologies (Cat# 15070-063)

    Méthodes

    Le test SpectraMax Glo Steady-Luc Reporter a un flux de travail simplifié. La solution de travail est mélangée dans un rapport 1:1 avec le milieu dans chaque puits de la microplaque, où les cellules exprimant la luciférase sont étalées. La plaque est ensuite recouverte et mélangée pour permettre une lyse cellulaire complète avant que les signaux luminescents ne soient lus sur le lecteur de microplaques multimode SpectraMax i3x (Figure 1). L'acquisition et l'analyse des données sont facilement rationalisées lors de l'utilisation du protocole préconfiguré dans le logiciel Softmax Pro.

    Figure 1. Flux de travail du kit de test SpectraMax Glo Steady-Luc Reporter.

    Courbe étalon de la luciférase

    Pour identifier la plage de détection linéaire de ce dosage, une courbe standard a été construite pour mesurer le RLU en fonction de la concentration de luciférase. Tous les composants du kit de dosage SpectraMax Glo Steady-Luc Reporter ont d'abord été laissés s'équilibrer à température ambiante. La solution de travail SpectraMax Glo Steady-Luc a été préparée en ajoutant de la D-Luciférine au tampon Steady-Luc Assay dans un rapport de 1 mg à 4 ml. Une dilution en série de dix fois de luciférase purifiée dans du PBS avec 0,01 % de BSA à partir d'une concentration de 1 x 10 6 fg/puits a été préparée, et 25 L de chaque concentration ont été ajoutés en triple à une plaque blanche solide de 384 puits. Ensuite, 25 L de solution de travail SpectraMax Glo Steady-Luc ont été ajoutés aux puits contenant la luciférase et les contrôles. La plaque a été secouée et incubée à l'obscurité pendant 10 minutes. À l'aide du lecteur SpectraMax i3x, le protocole de test SpectraMax Glo Steady-Luc Reporter préconfiguré dans le logiciel SoftMax Pro a été utilisé pour mesurer la luminescence. Après détection, le protocole génère automatiquement une courbe des données.

    Test de transfection et de dilution cellulaire

    Une partie du développement du test pour un test de gène rapporteur consiste à optimiser le nombre de cellules et la quantité de plasmide nécessaires pour donner un signal robuste pour le criblage. Un essai de dilution cellulaire a été réalisé avec deux quantités différentes de pGL4.13 luciférase de luciole en commençant dans des plaques à 6 puits. Les cellules CHO-K1 ont été transfectées de manière transitoire avec 1,7 g ou 0,8 g par puits de vecteur pGL4.13[luc2/SV40], qui code pour le gène de la luciférase luc2 sous le contrôle de l'activateur/promoteur précoce SV40, ou vecteur pGL3-Basic (contrôle) , qui manquait de séquences de promoteur et d'amplificateur. Après 24 heures, les cellules ont été trypsinisées et ensemencées à 100 ul/puits dans une plaque à 96 puits en commençant à 30 000 cellules/puits avec des dilutions ultérieures de 2 fois. 100 L/puits de solution de travail Steady-Luc ont été ajoutés aux puits. La plaque a été recouverte pour protéger les réactifs de la lumière et mélangée à l'aide d'un agitateur orbital. Après 10 minutes, la luminescence a été mesurée et enregistrée sur le lecteur SpectraMax i3x en utilisant le protocole de test SpectraMax Glo Steady-Luc Reporter préconfiguré. Le protocole préconfiguré se trouve dans la section Reporter Assays sous l'onglet Protocol Library ou sur le site Web de partage de protocole SoftMax Pro Software (www.softmaxpro.org).

    Dépistage des candidatures

    Un écran de test de gène rapporteur a été simulé en effectuant plusieurs lectures d'une plaque de cellules transfectées par la luciférase pGl4 firefly à l'aide du kit SpectraMax Glo Steady-Luc Reporter Assay. Les cellules ont été transfectées comme décrit précédemment et plaquées à 30 000 cellules par puits dans une plaque à 96 puits et cultivées pendant une nuit. Le jour du test, la plaque a été équilibrée à température ambiante, puis 100 L de solution de travail Steady-Luc reconstituée contenant de la D-Luciférine ont été ajoutés à chaque puits. La plaque a été recouverte et mélangée sur un agitateur orbital pendant cinq minutes, puis placée dans un lecteur SpectraMax i3x et mélangée. La luminescence a été lue toutes les cinq minutes pour un total de cinq heures avec trois secondes d'agitation orbitale avant chaque lecture.

    Résultats

    Courbe étalon de la luciférase

    À titre de comparaison, la courbe standard pour identifier la plage de détection du test a également été réalisée avec un test de luciférase luminescente d'un concurrent. Dans les deux cas, les tests ont identifié une relation linéaire entre la luminescence et la concentration de luciférase (Figure 2). Le R2 les valeurs pour la luciférase étaient de 0,998 en utilisant le kit de dosage SpectraMax Glo Steady-Luc Reporter et de 0,999 en utilisant le kit de dosage concurrent. Un test t apparié de données normalisées indique des résultats équivalents à chaque concentration (P < 0.05). Les calculs ont été effectués à l'aide de GraphPad Prism. En utilisant les deux kits, la limite inférieure de détection (LLD) de la luciférase était de 5 femtogrammes/puits au format 384 puits.

    Figure 2. Courbe standard de la luciférase au format 384 puits. Résultats linéaires d'une dilution 10 fois de luciférase purifiée dans le test SpectraMax Glo Steady-Luc Reporter (vert) (R2 = 0,999) ou un test de compétiteur (rouge) (R 2 = 0,998). Dans les deux tests, le LLD = 5 femtogramme/puits.

    Mesure de la luciférase dans les cellules transfectées

    Le titrage des cellules CHO-K1 transfectées de manière transitoire avec de la luciférase à partir de 30 000 cellules/puits a été pipeté dans les puits suivi par la solution de travail Steady-Luc Reporter. Montré dans la figure 3, le test SpectraMax Glo Steady-Luc Reporter et le test de luciférase de lueur concurrente ont démontré une relation linéaire entre le nombre de cellules et la luminescence. Pour les cellules qui ont reçu 0,8 µg de vecteur de luciférase pGL4.13, R 2 = 0,995 en utilisant le kit de test SpectraMax Glo Steady-Luc Reporter et R 2 > 0,999 en utilisant le kit de test concurrent. Les deux kits ont détecté la plus faible dilution de cellules testées dans le test, 468 cellules/puits.

    Figure 3. Mesure de la luciférase dans les cellules transfectées. Des cellules CHO-K1 confluentes à 90 % ont été transfectées avec 1,7 ug de plasmides luciférase pGL4 (Firefly) (rouge), 0,8 pGL4 (Firefly) (vert) ou pGL3 (contrôle) (bleu). (UNE) Test SpectraMax Glo Steady-Luc Reporter (R 2 >0.995 à 0,8 g de plasmide) et (B) Essai concurrent (R2 = 0,999 à 0,8 µg de plasmide). Les deux kits ont détecté le plus petit nombre de cellules/puits dans le dosage (468 cellules/puits).

    Dépistage des candidatures

    Le test SpectraMax Glo Steady-Luc Reporter est un test de luminescence basé sur la lueur qui fournit une fenêtre de temps de signal étendue (Figure 4). Une plaque avec des cellules CHO-K1 exprimant la luciférase à 30 000 cellules/puits est lue toutes les cinq minutes pour simuler le traitement par lots des plaques de criblage. À cinq heures, le signal est à moins de 20 % de la valeur initiale. Sur chaque plaque individuelle dans un écran d'analyse de rapporteur, un contrôle pour la normalisation des données au bruit de fond est inclus afin que les données puissent être comparées sur de nombreuses plaques. Comme le montre la figure 5, le signal reste à moins de 15 % sur 20 plaques, ce qui suggère la faisabilité de l'exécution de 20 plaques sur une période de 90 minutes avec ce test.

    Figure 4. Signal de la luciférase dans les cellules CHO-K1 au fil du temps. Des cellules CHO-K1 ont été transfectées avec de la luciférase. Le jour du test, la plaque a été équilibrée à température ambiante, puis 100 L de solution de travail Steady-Luc reconstituée contenant de la D-Luciférine ont été ajoutés à chaque puits. La plaque a été recouverte et mélangée sur un agitateur orbital pendant cinq minutes, puis placée dans un lecteur SpectraMax i3x et mélangée. La luminescence a été lue toutes les cinq minutes pendant cinq heures avec trois secondes d'agitation orbitale avant chaque lecture.

    Figure 5. Dépistage des demandes. Données brutes de cellules CHO-K1 transfectées par la luciférase dans le test SpectraMax Glo Steady-Luc. Le signal moyen des cellules transfectées par la luciférase est tracé comme exemple de traitement par lots au cours d'un essai de criblage dans lequel une plaque est lue toutes les cinq minutes. Sur les plaques de criblage, des contrôles d'arrière-plan sont utilisés pour normaliser les données afin que les comparaisons puissent être comparées sur de nombreuses plaques.

    Conclusion

    Les dosages de rapporteurs basés sur la luciférase utilisant des lecteurs de microplaques à luminescence sont devenus de plus en plus populaires pour l'analyse à haut débit des applications de biologie chimique et de découverte de médicaments. Le kit de test SpectraMax Glo Steady-Luc Reporter permet une quantification sensible de l'expression de la luciférase de luciole dans les cellules de mammifères. En appliquant un protocole expérimental homogène, le mélange de substances spécialement formulé dans ce kit prolonge considérablement la fenêtre de temps avec un signal stable, permettant ainsi le traitement par lots des plaques dans les tests de dépistage. Ce kit de dosage est optimisé pour les lecteurs de microplaques SpectraMax de Molecular Devices, avec un protocole préconfiguré fourni aux clients utilisant le logiciel SoftMax Pro de Molecular Devices pour l'acquisition et l'analyse de leurs données.


    Vecteurs de gènes de rapporteur

    Les vecteurs sont des plasmides, des éléments extrachromosomiques, qui portent des séquences de gènes rapporteurs pour une livraison dans des cellules en culture. Non seulement les vecteurs fournissent le gène rapporteur, mais peuvent également avoir plusieurs sites de clonage, promoteurs, éléments de réponse, séquences de polyadénylation, marqueurs sélectionnables de mammifères ou autres éléments de séquence qui aident à l'expression et à la sélection. Les vecteurs rapporteurs sont essentiels pour le succès des tests rapporteurs.

    PGL4 Luciferase Reporter Vectors Codant Firefly et Renilla Luciférase

    Étant donné que les vecteurs sont utilisés pour délivrer le gène rapporteur aux cellules hôtes, les séquences régulatrices telles que les sites de liaison aux facteurs de transcription et les modules promoteurs au sein du squelette du vecteur peuvent entraîner un bruit de fond élevé et des réponses anormales. Il s'agit d'un problème courant pour les vecteurs rapporteurs de mammifères, y compris les vecteurs rapporteurs de luciférase pGL3. Nos scientifiques ont appliqué la stratégie réussie de « nettoyage » décrite pour les gènes rapporteurs à l'ensemble du squelette du vecteur pGL3, en supprimant les séquences régulatrices cryptiques dans la mesure du possible, tout en maintenant la fonctionnalité du rapporteur. De plus, la région de clonage multiple a été repensée avec un site SfiI unique pour un transfert facile de l'élément d'ADN d'intérêt, l'origine fl de réplication supprimée et un intron supprimé. En outre, un signal poly(A) synthétique/site de pause transcriptionnelle a été placé en amont de la région de clonage multiple (dans les vecteurs sans promoteur) ou du promoteur HSV-TK, CMV ou SV40 (dans les vecteurs contenant un promoteur). Cet effort considérable a abouti au squelette vectoriel totalement repensé et unique des vecteurs pGL4. Il existe également une série de vecteurs pGL4 avec des délétions partielles du promoteur CMV pour une utilisation nuancée du promoteur fort.

    La famille pGL4 de vecteurs de luciférase intègre une variété de fonctionnalités telles que votre choix de luciole optimisée ou Renilla gènes de luciférase, versions Rapid Response™ pour une réponse temporelle améliorée, marqueurs sélectionnables de mammifères, vecteurs de base sans promoteurs, vecteurs de contrôle contenant des promoteurs et vecteurs prédéfinis avec votre choix de plusieurs éléments de réponse (Figure 6).

    Figure 6. La famille de vecteurs rapporteurs de luciférase pGL4 incorpore une variété de caractéristiques supplémentaires, telles qu'un choix de gènes de luciférase, des versions de réponse rapide et commerciales, une variété de marqueurs et vecteurs sélectionnables de mammifères avec ou sans promoteurs et éléments de réponse.

    Vecteurs pNL codant pour la nanoLuc® luciférase

    La luciférase NanoLuc® est disponible dans une variété de vecteurs pour une utilisation dans les tests de gènes rapporteurs de contrôle transcriptionnel. Ces vecteurs pNL sont basés sur le squelette du vecteur pGL4 et offrent donc bon nombre des mêmes avantages : suppression des sites de liaison aux facteurs de transcription et d'autres éléments régulateurs potentiels pour réduire le risque de résultats anormaux, transfert de séquence facile à partir de plasmides existants et choix de plusieurs des séquences de promoteur, y compris aucun promoteur, un promoteur minimal et des promoteurs viraux. La famille de vecteurs offre un choix de gènes NanoLuc® (non fusionnés Nluc, PEST-déstabilisé NlucP et sécrété secNluc). Ces variations du gène NanoLuc® sont optimisées pour les codons et ont eu de nombreux éléments régulateurs potentiels ou d'autres caractéristiques indésirables telles que les sites d'enzymes de restriction communs supprimés.

    De plus, il existe des vecteurs rapporteurs de coïncidence qui codent à la fois pour NanoLuc® et pour les luciférases de luciole sur un seul transcrit. Ces vecteurs sont livrés sans promoteur, un promoteur minimal ou un promoteur CMV pour une utilisation dans le criblage à haut débit. Étudiez le taux de renouvellement des protéines de deux protéines de signalisation clés impliquées dans la réponse au stress cellulaire à l'aide de vecteurs rapporteurs.

    Vecteurs de reporter

    Notre vaste gamme de vecteurs rapporteurs bioluminescents à la pointe de la technologie comprend les Vecteurs pGL4 —la dernière génération de luciole et Renilla vecteurs rapporteurs de la luciférase, et le Vecteurs pNL, qui contiennent le gène rapporteur de la luciférase NanoLuc®.


    Résumé

    Des épisodes répétés d'ischémie dans le cœur entraînent une fibrose et éventuellement une insuffisance cardiaque. Bien que certains gènes, tels que SOD ou hemoxygenase et antisens à l'AT1R, ACE et (β1-AR peut fournir une protection à court terme du cœur contre l'ischémie, il n'existe aucun mécanisme connu pour répondre constamment à des incidences répétées d'ischémie. Nous avons émis l'hypothèse qu'un « vecteur vigilant », conçu pour être exprimé spécifiquement dans le cœur et activer les gènes thérapeutiques uniquement pendant l'hypoxie, fournirait une cardioprotection. Pour atteindre la spécificité cardiaque, nous avons inséré un promoteur MLC2v dans un virus adéno-associé (AAV) conçu pour délivrer AS à AT1R et gfp. Dans des expériences in vitro dans des cardiomyocytes (cellules H9C2), le MLC2v-AAV-gfp a conduit l'expression génique dans toutes les cellules à des niveaux comparables à un promoteur du cytomégalovirus (CMV). Dans des expériences in vivo, le rAAV-MLC2v-gfp a été injecté par voie intraveineuse à des souris ou des rats. L'ADN de la protéine de fluorescence verte (GFP) était localisé dans les reins, le cœur (ventricule droit et gauche), les poumons, les surrénales et la rate. L'ARNm de la GFP, cependant, n'était exprimé que dans le cœur et absent dans d'autres tissus. Pour activer le transgène rAAV pendant l'ischémie, nous avons inséré un élément de réponse à l'hypoxie (HRE). Cela régule positivement la transcription lorsque O2 les niveaux sont bas. Ainsi, il y a 4 composants au vecteur vigilant un gène commutateur (HRE), un promoteur spécifique du cœur (MLC2v), un gène thérapeutique (AS-AT1R) et un gène rapporteur (gfp). Pour faire taire ou abaisser le niveau basal d'expression tout en conservant la spécificité, nous avons réduit la longueur du promoteur MLC2v de 3 kb à 1775 pb ou 281 pb. Le promoteur tronqué est également efficace dans l'expression spécifique du cœur. Des études préliminaires avec le rAAV-HRE-gfp in vitro montrent une expression accrue dans 1% O2 en 4 à 6 heures. En ajoutant un facteur supplémentaire inductible par l'hypoxie (HIFα) (5 g), l'expression de MLC2v-gfp est multipliée par 4 dans 1% O2. Amplification supplémentaire du gène jusqu'à 400 fois dans 1% O2 peut être réalisé avec un double plasmide. La construction peut servir de prototype de « vecteur vigilant » pour activer des gènes thérapeutiques dans un tissu spécifique avec des signaux physiologiques.

    Le cœur humain peut être sujet à des épisodes répétés d'hypoxie, qui entraînent des lésions silencieuses ou manifestes du tissu myocardique. 1 Cumulativement, cela peut conduire à une insuffisance cardiaque. Pour tenter de lutter contre cela par la thérapie génique, nous proposons le développement d'un « vecteur vigilant », inactif jusqu'à son activation par l'hypoxie, qui protégerait le cœur lors de l'ischémie avec des gènes thérapeutiques. Ce concept nécessite l'ingénierie d'un vecteur stable qui contiendrait 4 éléments (Figure 1) : (1) un vecteur sûr qui pourrait atteindre le cœur par injection systémique et montrer une expression stable du gène dans le cœur (2) un gène thérapeutique pour cardioprotection contre l'ischémie (3) un promoteur tissu-spécifique pour conduire le transgène à exprimer l'ARNm dans le cœur uniquement et (4) un commutateur génique qui activerait le promoteur tissu-spécifique en réponse à l'hypoxie et qui s'arrêterait en réponse à normoxie.

    Figure 1. Conception générale d'un "vecteur vigilant" qui pourrait être appliqué pour une protection constante contre l'ischémie cardiaque, le diabète de type 1, l'accident vasculaire cérébral, la crise cardiaque, le cancer ou même le bioterrorisme. Les principaux éléments sont (1) un vecteur sûr et stable (2) un commutateur génique (3) un promoteur tissu-spécifique et (4) des gènes thérapeutiques (avec un gène rapporteur pour surveiller son activité).

    Pour le vecteur, le virus adéno-associé (AAV) s'avère être un vecteur stable et non pathologique. 2,3 Il existe plusieurs gènes qui pourraient être pris en compte pour la protection du cœur pendant l'ischémie. Dans une étude précédente 4 nous avions trouvé que le récepteur de l'angiotensine II de type 1 (AT1-R) antisens (AS) a protégé les cœurs de rats de l'ischémie-reperfusion. Dzau et al 5 ont récemment montré que les souris transgéniques avec l'hémoxygénase sont protégées de l'ischémie cardiaque. La superoxyde dismutase protège contre les radicaux superoxydes générés lors de l'ischémie ou de la reperfusion. 6 Ainsi, ces gènes sont de bons choix pour les transgènes cardioprotecteurs dans le vecteur. Pour l'expression tissu-spécifique de l'AAV dans le cœur, nous avons étudié la forme ventriculaire de la chaîne légère de la myosine (MLC-2v). 7,8 L'expression de MLC-2v est importante dans le développement du cœur pendant l'embryogenèse, et des altérations de l'expression de MLC-2v produisent des anomalies cardiaques. 8 Chez l'homme, la cardiomyopathie est associée à des mutations ponctuelles dans MLC-2v. 9 MLC-2v semble être hautement spécifique pour les cœurs, à la fois pendant le développement embryonnaire et dans le développement et la maturité postnatals. Le promoteur MLC-2v est de 3,0 kb, mais les séquences qui lui confèrent la propriété de spécificité cardiaque sont à moins de 250 pb, proches de la boîte TATA. 8,9-13 Nous avons testé la spécificité d'un promoteur MLC-2v de 1700 kb et 281 bp dans des AAV délivrés in vitro et in vivo. Pour activer le vecteur, nous avons testé un élément régulateur de l'hypoxie (HRE) qui est activé en transactivant le facteur inductible de l'hypoxie (HIF-1) en réponse à une réduction de l'oxygène. 14,15 Dans des conditions normoxiques, la sous-unité HIF-1α est indétectable car elle est dégradée par les protéosomes, 16,17 mais pendant l'hypoxie, HIF-1α n'est plus dégradé, il s'accumule de façon exponentielle à mesure que l'hypoxie cellulaire augmente. 18 Bien que nous n'ayons pas terminé et testé tous les composants d'un vecteur vigilant, nous présentons les résultats d'une étude sur la spécificité cardiaque de MLC-2v et son interaction avec HRE et HIF-1α.

    Méthodes

    Construction d'AAV plasmidique et recombinant

    Le vecteur dérivé d'AAV linéaire simple brin peut être adapté pour plusieurs gènes et promoteurs entre les répétitions terminales inversées (ITR) à chaque extrémité (Figure 1). Nous avons inséré un gène rapporteur, une protéine fluorescente verte (GFP) et un promoteur MLC-2v de rat de 1,7 kb (pMLC-2v-GFP). Des procédés de préparation d'AAV recombinant (rAAV) ont été décrits précédemment. 19 Le pMLC-2v-GFP a été emballé dans AAV-2 (rAAV-MLC-2v-GFP).

    Un fragment de 281 pb (-264 à +17, Genebank: U26708) du promoteur MLC-2v a été amplifié par une réaction en chaîne par polymérase (PCR) à partir de pMLC-2v-GFP avec la paire d'amorces conçue avec des sites 5' Xhol ou 3' HindIII sur les extrémités. Le fragment MLC-2v a été digéré par Xhol et HindIII et ligaturé au gène de plasmide luciférase (pGL)-SV40 (Promega) digéré par Xhol/HindIII pour générer pGL-MLC.

    Sur la base de Semenza et al, 14 une séquence d'énolase humaine (ENO) 1 HRE de 68 pb (-416 à -349, banque de gènes : X16287) a été insérée dans le flanc 5' du promoteur MLC-2v dans le pGL-MLC pour générer pGL-HRE /MLC.

    pCEP4/HIF-1α, qui contient la séquence d'ADNc de HIF-1α humain en aval d'un promoteur de cytomégalovirus, était un cadeau aimable du Dr Semenza (Johns Hopkins University).

    Transfection in vitro

    Une lignée cellulaire de myoblastes cardiaques embryonnaires de rat, 20 H9c2 (ATCC : CRL1446) ou des cellules de gliome C6 (ATCC : CCL-107) ont été cultivées dans du DMEM additionné de pyruvate de sodium, 10 % de sérum bovin foetal (FBS) ou 5 % de FBS dans un incubateur (Quene Systems, Inc) avec une atmosphère humidifiée de 5% de CO2 et 95% d'air à 37°C. Les conditions d'hypoxie ont été obtenues à l'aide de chambres d'hypoxie (capteurs d'oxygène) par évacuation et gazage avec 1% d'O2/5% CO2/94% N2 à plusieurs reprises, en scellant hermétiquement les chambres, puis en les incubant à 37°C.

    Pour examiner la spécificité du promoteur MLC-2v dans les cellules, les cellules H9c2 et C6 ont été transfectées avec pGL-MLC (1 g/puits) et le plasmide de contrôle interne pRL-TK (50 ng/puits, Promega) en utilisant la lipofectamine (Invitrogen) dans plaques 6 puits. Vingt-quatre heures après la transfection, des lysats cellulaires ont été préparés. Les dosages de luciférase ont été effectués avec le système de dosage de luciférase double (Promega) et quantifiés avec un luminomètre Monolight 3010 (Pharmingen). Les résultats sont exprimés sous forme de rapport entre l'activité de la luciférase de la luciole et Renilla activité luciférase.

    Pour les expériences de cotranfection avec pCEP4/HIF-1α, H9c2 a été transfecté avec 2 g/puits de pGL-HRE/MLC, 100 ng/puits de plasmide de contrôle pRL-TK, diverses quantités de pCEP4/HIF-1alpha et un vecteur vide de sorte que toutes les cellules ont reçu un total de 6 g de plasmide dans des boîtes de 60 mm. Vingt-quatre heures après la transfection, le milieu a été changé et les plaques dupliquées ont été incubées à 1% ou 20% O2 pendant 24 heures avant la préparation des lysats.

    Expression de l'AAV in Vivo

    Tous les animaux ont été maintenus dans une pièce à température contrôlée selon un cycle jour/nuit de 12 heures avec un accès libre à la nourriture et à l'eau. Le comité institutionnel de protection et d'utilisation des animaux de l'Université de Floride a approuvé toutes les procédures expérimentales.

    Expression de l'AAV chez l'animal adulte

    Des souris mâles adultes BALB/c (n = 6) ont été obtenues auprès de Harlan (Indianapolis, Ind) et anesthésiées avec du pentobarbital (80 mg/kg). 10 10 particules infectieuses de rAAV-MLC-2v-GFP (100 L) ont été injectées par voie intraveineuse. Après 2 à 8 semaines, les animaux ont été profondément anesthésiés avec du pentobarbital (120 mg/kg). Des échantillons de rate, de foie, de poumon, de rein, de ventricule gauche, de testicule et de cerveau ont été disséqués et congelés sur de la neige carbonique.

    Expression AAV chez le jeune animal

    Des rats mâles Sprague Dawley âgés de cinq jours (n=3) ont été obtenus accompagnés de leur mère à Harlan. Ils ont été gardés avec leur mère jusqu'à l'âge de 21 jours. A 6 jours d'âge, les chiots ont été anesthésiés avec du Metofane injecté par voie intracardiaque avec 10 10 particules infectieuses de rAAV-MLC-2v-GFP (25 L) ou le même volume de solution saline qu'un témoin. Quatre semaines plus tard, les rats ont été profondément anesthésiés avec de la kétamine, de la xylazine et de l'acépromazine (30, 6 et 1 mg/kg, respectivement, par voie sous-cutanée) et perfusés avec une solution saline glacée via le ventricule gauche. Des échantillons de rate, de foie, de poumon, de rein, de ventricule gauche, de testicule, de cœur et de cerveau ont été disséqués et congelés sur de la neige carbonique pour les mesures d'ADN, d'ARN et de protéines GFP.

    Détection de GFP

    L'ARN total et l'ADN ont été isolés en utilisant le réactif TRIZOL. L'expression de la protéine fluorescente verte (GFP) a été analysée par PCR nichée. Les amorces spécifiques de la GFP utilisées dans la première amplification étaient 5'-CAGCGGAGAGGGTGAAGGTG-3'(sens) et 5'-CAGGGCAGACTGGGTGGACA-3' (antisens). Les amorces spécifiques de GFP utilisées dans la seconde amplification étaient 5'-GCCA-CATACGGAAAGCTCAC-3' (sens) et 5'-ATGGTTGTCTG-G GAGGAGCA-3' (antisens).

    RT-PCR

    Vingt g d'ARN total ont été digérés par la DNase I dans un mélange réactionnel de 40 L constitué de 40 U de DNase I et de 33 U d'inhibiteur de RNase. La transcription inverse (RT) et la première amplification ont été réalisées dans un seul tube. Quatre L d'ARN (2 mg) prétraités avec la DNase I ont été ajoutés à 20 ml de volume final de la réaction PCR. La première amplification a été réalisée dans les conditions suivantes : 60 minutes à 37°C (RT) 4 minutes à 94°C 35 cycles de 1 minute à 94°C 1 minute à 58°C (hybridation) 1 minute à 72°C et une période d'extension finale de 7 minutes à 72°C dans des cycles thermiques d'ADN PE 480. Un L de produit de la première amplification a été ajouté à 25 L de volume final de la réaction PCR. Les conditions de la seconde amplification étaient les mêmes que la première à l'exception de l'ajout de 30 cycles avec annelage à 60°C.

    PCR

    Un g d'ADN a été amplifié par PCR nichée pour détecter l'expression de la GFP. Les procédures étaient les mêmes avec la détection de GFP dans l'ARN (RT-PCR), sauf que la digestion par la DNase I et la transcription inverse (RT) ont été omises.

    Électrophorèse

    Les produits d'amplification ont été analysés sur 1% d'agarose coloré au bromure d'éthidium. La taille attendue du produit était de 489 pb.

    Coloration par immunofluorescence

    Les tissus ont été incubés dans la solution de Zamboni pendant la nuit et cryosectionnés à 20 µm d'épaisseur. Les coupes ont été bloquées avec du tampon de blocage (10 mmol/L de TBS, 1,5 % de sérum de chèvre normal et 1 % de BSA) pendant 1 heure et incubées dans un anticorps primaire (0,1 % d'anti-GFP, IgG de lapin) pendant une nuit à 4°C. After washing with TBS, the sections were incubated with 0.5% anti-rabbit IgG FITC in the dark at room temperature for 1 hour. The sections were washed and put on slides. The slides were covered by slips with fluoromount G when dry. GFP was detected within 3 hours by confocal microscopy.

    Résultats

    In Vitro

    The pGL-MLC was specifically expressed in cardiomyocytes. Figure 2 shows the luciferase activity of pGL-MLC-2v in cardiomyocytes (H9c2) and a lack of expression in a nonmyocardial cell line (C6). The relative luciferase activity ratio of H9c2 cells to C6 cells was 29.38±13.11. The uptake efficiency in both cell types was 90%.

    Figure 2. The expression of luciferase activity (relative to control) in cardiac (H9c2 cells) versus glioma (C6) cells after treatment with pGL-MLC. Myocardial cells specifically expressed the transgene. Cells were transfected with control pRL-TK (50 ng/well) and pGL-MLC (1 μg/well) plasmids. Duplicate plates were incubated at 20% O2 for 24 hours (mean±SD, n=3 independent experiments).

    In Vivo

    PCR of DNA showed the transduction of rAAV-MLC-2v-GFP in many tissues at 4 weeks after a systemic injection. The tissue-specific expression of GFP under MLC-2v promoter was examined by RT-PCR of RNA in the adult mouse tissues and young rats (Figure 3). GFP DNA was detected in the spleen, liver, lung, kidney, and heart. However, GFP mRNA was detected only in the heart.

    Figure 3. Top, Expression of GFP DNA in various tissues of the young rat detected by PCR. Bottom, Expression of GFP mRNA in the same tissues, detected by RT-PCR. Analysis was made of DNA and RNA extracted from the tissues 4 weeks after a single systemic injection of rAAV-MLC-2v-GFP.

    Four weeks after intracardiac injection of rAAV-MLC-2v-GFP, the presence of GFP in various tissues of rats was further examined by immunofluorescence staining (Figure 4). The green epifluorescence of the protein was clearly apparent in the heart and absent in the control (no GFP). GFP was undetectable in the kidney and liver of the same animals and undetectable in controls.

    Figure 4. Expression of rAAV-MLC-2v-GFP was present in the heart, but absent in the liver and kidney at 4 weeks after transduction in young rat. Control: rAAV without GFP. The immunofluorescence staining with an antibody to green fluorescent protein reveals intense expression in heart only, which matches the expression of mRNA from the same animal in Figure 3.

    Hypoxia did not induce an increase in transgene expression of the pGL-HRE/MLC (Figure 5). However, hypoxia induces a 3 to 4-fold increase in transgene expression when the HRE-MLC-2v enhancer/promoter complex is in the presence of 0.5 to 4 μg of HIF-1α in H9c2 cells (Figure 5).

    Figure 5. Hypoxia induces a 3- to 4-fold increase in transgene expression when the HRE/MLC enhancer/promoter complex is in the presence of rHIF-1alpha. H9c2 cells were cotransfected with 2 μg/well pGL-HRE/MLC (281 bp) and 100 ng/well pRL-TK, in the absence of rHIF-1α or in the presence of various amount of rHIF-1α plasmid, respectively. Twenty-four hours after transfection, duplicates were exposed to 1% or 20% O2 for another 24 hours. The ratio of firefly luciferase/Renilla luciferase activity was normalized to the result obtained for cells transfected with pGL-HRE/MLC (281 bp) and exposed to 20% O2 (X-Fold). Expression at 1% relative to 20% O2 was calculated to determine the hypoxia induction ratio. (mean±SD, n=3 independent experiments).

    Discussion

    The results demonstrate that the MLC-2v promoter incorporated into a rAAV vector can drive a reporter gene specifically in the heart. rAAV-MLC-2v-GFP was injected systemically, either through direct injection into the heart or via the jugular vein. Measurements of DNA showed that the vector was taken up into multiple tissues, including liver, lung, kidney, heart, and spleen. Although the rAAV-MLC-2v-GFP was taken up into many tissues after a single injection, the transgene (gfp) was only expressed in heart tissue. This was found in both mice and in rats. In two animals we found low-level expression in the liver but not in the kidney or other tissues. As AAV has limited loading capacity, we tested two truncated forms of MLC-2v. We used the 1700 bp length for the promoter in vivo and 250 bp in vitro to attempt to reduce basal levels without losing specificity. Both lengths contain the heart-specific cis regulatory elements 8 that endow the MLC-2v with its heart-specific responsiveness. 9,10 In glioma cells (C6) there was no expression of luciferase, although there was comparable uptake efficiency with or without the MLC-2v promoter.

    Attaching HRE to the MLC-2v with luciferase (Luc), as the transgene, did not alter basal expression in vitro at 20% O2. However, the HRE plus MLC-2v did not respond to 1% O2. With an HRE-SV40 promoter-Luc plasmid in heart cells, we have shown elsewhere that HRE will drive the promoter up to 7-fold under hypoxia within 4 to 6 hours. 21 We considered that the HRE/MLC-2v complex may have reduced the accessibility of the HIF-1α binding. To test this, we used an additional plasmid expressing the hypoxia inducible factor-1α (HIF-1α). 14–17 When we cotransfected a plasmid containing HIF-1α cDNA with pGL-HRE/MLC and exposed the cells to 1% oxygen we noted a 4-fold increase in Luc expression. Thus, the results indicate that MLC-2v can be used as a specific promoter for heart tissue, and HIF-1α plus HRE (but not HRE alone) will cause the MLC-2v to increase transgene expression in vitro by at least 4-fold in response to hypoxia. This is not a major limitation because dual vectors overcome the vector size limitation 22 and increase gene expression. 23 We are not yet satisfied that a 4-fold increase is sufficient to provide a cardioprotective effect with a therapeutic gene. A double plasmid approach that produces a powerful chimeric transcription factor consisting of the yeast transactivator factor GAL4 DNA binding domain and the p65 transactivation domain 24,25 is being tested. 21 Incorporating the HRE in this double plasmid system with SV40 promoter increased Luc gene expression by 400-fold when activated by hypoxia. 21

    The concept of a vigilant vector for cardioprotection can be applied generally to a number of other disease states. For example, in diabetes type 1, glucose would be the gene switch and insulin and its necessary enzymes would be the transgenes. The tissue specificity could be limited to the pancreas or to muscle. In cancer, tumor markers could be the gene switch, and the transgenes could be tumor suppressors. In heart attacks the switch would again be hypoxia or a protein marker and the transgene tPA. Similarly in stroke, hypoxia could be the switch and GFAP the tissue-specific promoter with hemoxygenase or superoxide dismutase or AT1-R-antisense as the therapeutic genes. For the vector, the rAAV seems to have the most desirable qualities of being safe and stable for a very long time. 2,3 Obviously each vigilant vector has to be designed and thoroughly tested, both in vivo and in vitro. Basal levels times of response, tissue specificity and amplification of signals are all challenges to be met. The present results represent promising new data for the development of a vigilant vector for long-term protection of cardiac performance during exposure to hypoxia.


    Tol2in frog

    Xénope laevis has been a useful model animal in developmental biology. Récemment, Xenopus tropicalis, a relative of X. laevis, is becoming an important model frog. It is amenable for use in genetic studies because of its unique features in comparison with X. laevis, specifically its diploid genome, smaller body size, and shorter generation time. Transgénique X. tropicalis have been constructed based on the restriction enzyme-mediated integration technique, which requires careful treatments of eggs and sperm [24].

    To develop an alternative and simpler method for creating transgenic X. tropicalis, the activity of the Tol2 transposon system was tested in Xenopus. First, both a Tol2 transposon-donor plasmid and the transposase mRNA were introduced into two-cell stage X. tropicalis et X. laevis embryos by microinjection. The transposon construct was excised from the donor plasmid, indicating that the Tol2 transoposon system is active in these Xenopus spp. [25]. Second, a donor plasmid that harbored a Tol2 construct containing the GFP expression cassette was co-injected with the transposase mRNA into one-cell stage X. tropicalis embryos, and GFP- positive F0 frogs (30% to 40% of the injected embryos) were raised to adulthood. GFP-positive F1 progeny were produced by 30% to 40% of such F0 adults, indicating that the Tol2 transposon system can be used for transgenesis in Xenopus (Figure 4) [26]. However, the germline transmission frequency is still lower than frequencies in zebrafish transgenesis, in which more than 50% of injected F0 fish constantly transmit transposon insertions to the F1 generation, even without pre-screening of the F0 injected fish for GFP positives. Par conséquent, dans Xenopus improvement in transgenic frequency will be important in making the Tol2 transposon system a more powerful genetic tool.

    Transgenesis in Xenopus tropicalis. The synthetic transposase mRNA and a transposon donor plasmid containing a Tol2 construct with a ubiquitous promoter and the gene encoding green fluorescent protein (GFP) are co-injected into X. tropicalis fertilized eggs. Les Tol2 construct is excised from the donor plasmid [25] and integrated into the genome. In the study conducted by Hamlet and coworkers [26], injected GFP-positive tadpoles were raised to adulthood. Tol2 insertions created in germ cells are transmitted to the F1 generation. Germ cells of the injected frogs are mosaic, and, by crossing theinjected frog (founder) with wild-type frog, nontransgenic tadpoles and transgenic tadpoles heterozygous for the Tol2 insertion are obtained [26].


    PTK-GLuc Vector

    The pTK-GLuc Vector is a mammalian expression vector that encodes the secreted luciferase from the copepod Gaussia princeps as a reporter, under the control of the constitutive Herpes Simplex Virus thymidine kinase promoter. Gaussia Luciferase (GLuc) is a 20 kDa protein encoded by a "humanized" sequence, and it contains a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells into the cell culture medium (1,2). pTK-GLuc has a multiple cloning site (MCS) between the GLuc stop codon and the polyadenylation site. A neomycin resistance gene under the control of an SV40 promoter allows selection for stable integration of the plasmid into the mammalian cell genome using G418. Figure 1: pTK-GLuc multiple cloning site (MCS)
    The Gaussia Luciferase sequence is shown with a blue background. Only unique restriction sites are shown.

    DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.

    Points forts

    • TK promoter: 18&ndash771
    • GLuc coding: 802&ndash1359
    • Start codon: 802&ndash804
    • Stop codon: 1357&ndash1359
    • Signal peptide: 802&ndash852
    • Multiple cloning site (MCS) downstream of GLuc: 1360&ndash1391 (NotI, AgeI, XhoI, XbaI)
    • SV40 late polyadenylation signal: 1392&ndash1622
    • Neo promoter (SV40): 2215&ndash2550
    • Neomycin resistance gene 2602&ndash3396
    • Neo R poly-A(SV40 early): 3570&ndash3700
    • Bacterial replication ori (pMB1) 4730&ndash4142
    • Amp resistance 5761&ndash4901

    Product Source

    Caractéristiques

    • Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time points).
    • 90&ndash95% of GLuc activity is found in the cell culture medium, with the remaining 5&ndash10% detectable in cell lysates. This allows flexibility when assaying GLuc along with other cotransfected reporters.
    • The activity of GLuc is high and the GLuc assay is sensitive enough to detect very small amounts of GLuc enzyme activity.
    • GLuc is very stable in the cell culture medium so the GLuc activity detected reflects the amount of GLuc secreted by the transfected cells over a period of several days. GLuc can also be stored at 4°C for several days without any loss in activity.
    • GLuc does not use the same substrate as Cypridina Luciferase. Therefore, it is possible to assay both GLuc and CLuc independently in cell culture medium from cells expressing both reporters (3,4).
    • The pTK-GLuc Vector can be transfected into cells using any standard transfection protocol and stable cell lines can be established using Neomycin (G418) selection.

    GLuc 3´ end Forward Primer (20-mer)
    GCCAGCAAGATCCAGGGCCA (1310&ndash1325)

    GLuc 5´ End Reverse Primer (24-mer)
    TCAGGGCAAACAGAACTTTGACTC (829&ndash806)

    Application Features

    • The pTK-GLuc Vector can be used as a control for assessing the efficiency of transfection in mammalian cells. Plasmids containing other constitutive promoter elements are also available (see Companion products Sold Separately).
    • pTK-GLuc Vector has a multiple cloning site (MCS) between the GLuc stop codon and the polyadenylation signal. This allows the cloning of sequences that will be part of the GLuc mRNA, such as 3´ UTR sequences, that can be used for RNA stability, RNAi or miRNA target evaluation.
    • GLuc can be used as a stand alone reporter or in conjunction with other compatible reporters such as Cypridina Luciferase (CLuc) (3). GLuc and CLuc are ideally suited for co-expression as both are secreted and highly active enzymes providing ease of use and sensitivity (3,4).

    Storage Buffer

    10 mM Tris-HCl
    1 mM EDTA
    pH 7.5 @ 25°C

    1. Verhaegen, M. and Christopoulos, T.K. (2002). Anal. Chem . 74, 4378-4385.
    2. Tannous, B.A. et al. (2005). Mol. Là. 11, 435–443.
    3. Otsuji, et al. (2004). Anal. Biochimie. 329, 230-237.
    4. Wu, et al. (2007). Biotechniques. 42, 290-292.

    Ce produit est couvert par un ou plusieurs brevets, marques déposées et/ou droits d'auteur détenus ou contrôlés par New England Biolabs, Inc (NEB).

    Bien que NEB développe et valide ses produits pour diverses applications, l'utilisation de ce produit peut exiger que l'acheteur obtienne des droits de propriété intellectuelle supplémentaires de tiers pour certaines applications.

    Pour plus d'informations sur les droits commerciaux, veuillez contacter l'équipe Global Business Development de NEB à l'adresse [email protected]

    Ce produit est destiné à des fins de recherche uniquement. Ce produit n'est pas destiné à être utilisé à des fins thérapeutiques ou diagnostiques chez les humains ou les animaux.

    New England Biolabs (NEB) is committed to practicing ethical science &ndash we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Apprendre encore plus.

    Licenses

    Ce produit est destiné à des fins de recherche uniquement. Ce produit n'est pas destiné à être utilisé à des fins thérapeutiques ou diagnostiques chez les humains ou les animaux.

    By opening this package or by using the materials enclosed within Recipient is legally bound and accepts the following terms and conditions:

    Non-Commercial Entities: This product is covered by U.S. Patent No. 6,232,107 and other patents that are the legal property as assigned to Prolume Ltd./Nanolight Technologies. This product is licensed only to the purchasing laboratory-research group. Recipient agrees not to transfer this plasmid or derivatives of this vector to any other laboratory, person or research group, even if within the same institution. Recipient agrees not to alter or make any changes to the nucleotide coding sequence or secretory coding sequence of the luciferase(s) contained within without prior written permission from Prolume Ltd./Nanolight Technologies (www.nanolight.com). Recipient agrees not to file for any patent rights or inventions claiming any portion of the Luciferase(s) within the material without prior written permission from Prolume Ltd./Nanolight Technologies.

    Commercial For-Profit Entities & Non-Profit Foundations (herein referred to as Commercial Recipients): Commercial Recipients wishing to derive products, engage in the sale or license of any products, discover drugs, or make inventions by use of the materials enclosed, fully agree to the terms mentioned above for Non-Commercial entities AND ADDITIONALLY agrees to and are hereby bound to use the materials FOR EVALUATION PURPOSES ONLY. Commercial Recipient hereby agrees to destroy and cease use of any materials or derivatives containing any portion of these materials within 180 days from receipt. Commercial Recipient agrees not to use the materials for any use, other than the 180-day suitability evaluation without prior written permission or obtaining a valid license from Prolume Ltd./Nanolight Technologies.

    Any Recipient that does not accept the license terms mentioned above, shall return the unopened package and materials to NEB for a full refund.

    Marques

    BIOLUX® is a registered trademark of New England Biolabs, Inc.
    QIAGEN® is a registered trademark of Qiagen.


    The Pacific White Shrimp β-actin Promoter: Functional Properties and the Potential Application for Transduction System Using Recombinant Baculovirus

    A newly isolated Pacific white shrimp (Litopenaeus vannamei) beta-actin promoter SbaP and its derivative compact construct SbaP (ENX) have recently been demonstrated to promote ectopic gene expression in vitro and in vivo. To further explore the potential transduction application, this newly isolated shrimp promoter SbaP was comparatively tested with cytomegalovirus (CMV), simian virus 40 (SV40), polyhedrin (Polh), and white spot syndrome virus immediate early gene 1 (WSSV ie1) four constitutive promoters and a beta-actin promoter (TbaP) from tilapia fish to characterize its promoting function in eight different cell lines. Luciferase quantitation assays revealed that SbaP can drive luciferase gene expression in all eight cell lines including sf21 (insect), PAC2 (zebrafish), EPC (carp), CHSE-214 (chinook salmon), GSTEF (green sea turtle), MS-1 (monk seal), 293T (human), and HeLa (human), but at different levels. Comparative analysis revealed that the promoting activity of SbaP was lower (≤10-fold) than CMV but higher (2-20 folds) than Polh in most of these cell lines tested. Whereas, SbaP mediated luciferase expression in sf21 cells was over 20-fold higher than CMV, SV40, Polh, and TbaP promoter. Compared to the SbaP, SbaP (ENX), which was constructed on the basis of SbaP by deletion of two "negative" regulatory elements, exhibited no significant change of promoting activity in EPC and PAC2 cells, but a 5 and 16 % lower promoting effect in 293T and HeLa cells, respectively. Additionally, a recombinant baculovirus was constructed under the control of SbaP (ENX), and efficient promoter activity of newly generated baculoviral vector was detected both in vitro of infected sf21 cells and in vivo of injected indicator shrimp. These results warrant the potential application of SbaP, particularly SbaP (ENX) in ectopic gene expression in future.

    Mots clés: Promoter activity Recombinant baculovirus SbaP Shrimp beta-actin promoter The Pacific white shrimp.


    Luciferase promoter vector over p-AcGFP1-C1 vector - Biology

    Our promise to you:
    Guaranteed product quality, expert customer support.

    Reporter Stable Cell Lines

    As useful tools for scientific research, reporter stable cell lines are those cells involved in expression of reporter protein(s) which are engineered through integrating the reporter expression cassettes into cell genomes mediated by plasmid or lentivirus vectors. In the studies of life science and biotechnology, the commonly used reporter genes are visually identifiable including green fluorescent protein (GFP), red fluorescent protein (RFP), luciferase, secreted alkaline phosphatase (SEAP) etc.

    According to the upstream regulator of the reporter gene, reporter cell lines can be further divided into two groups: 1) Constitutive Reporter Cell Lines in which reporters are constitutively expressed under the control of a constitutive, strong promoter such as CMV promoter and 2) Inducible Reporter Cell Lines in which reporters are inducibly expressed under the control of a minimal promoter fused to multiple inducer response elements.

    Based on years of experience and in-depth investigation, scientists at Creative Biogene have established a large number of stable reporter cells in many popular cell lines suitable for multiple applications.

    Constitutive Reporter Cell Lines

    Inducible Reporter Cell Lines

    Table 1. Frequently Requested - Constitutive Reporter Cell Lines

    CatégorieJournalisteHost Cell
    Fluorescent ReporterGFP143 B, 324, 4T1, 9L, A375, A498, A549, AGS, Anip 973, ASPC -1, B16F0, B16 F10, Boy, BT 474, BV2, Bx Pc3, Ca761, CAOV3, Capan-1, Capan-2, CHO-K1, CNE2Z, colo205, Colon 38, COS-7, CT-26, DAOY, DU145, EKVX, FaDu, FEMX I, Flo-1, H460, H69, HCC70, HCT-116, HCT-15, HCT-8, HEK293, HEK293T, HeLa, Hep2, Hep 3B, HEP-G2, HGC27, HOP-62, HT 1080, HT-29, HTB 9, Huh-7, JURKAT, K562, KM-12, KM 28 BM, KU-7, LL/2, LnCap, LOXMIVI, LS 174, Ls180, L-SLM, MCF7, MDA-MB-231, MDA-MB-435, MDA-MB-435 2C5, MDA-MB-435 4A4, MDA-MB-453, MDA-MB-468, MDCK, Mel526, MIA-Paca 2, MMT 060562, MOLM13, MSTO-211H, MV3, N87, NALM6, NCI-H1299, NCIH1437, NCI-H1975, NCI-H661, NCI-N87, NIH3T3, NUGC 4, OPM2, OST, OVCAR-3, OVCAR-8, PaCa28, Panc-1, Pan02, PC-3, PC-12, R40LN, RGMI#186, RPMI8226, SH-SY5Y, SK-BR-3, SK-Hep-1, SK-LU-1, Sk-mel-5, SK-OV-3, SL4, SN12C, SNB-19, SOSN2, SW1116, SW480, SW620, SCC-25, T24T, T47D, TOV21, U2OS, U87 MG, U937, UACC257, UM-UC-3, UM-UC 14, Vcap, WiDr, XPAI
    Appel d'offres143 B, 4T1, A375, A549, ASPC-1, B16F0, B16-F10, Bx Pc3, BV2, CEM, CHO-K1, CNE2Z, Colon 38, Colo26, CT26.WT, Dunning3327, DAOY, FEMX I, FaDu, FG A-12, H9C2(2-1), HCT-116, HCT-8, HEK293, HEK293T, Hep2, Hep 3B, Hep G2, HGC27, HMMG/HOS, HT 1080, HT29, Huh-7, KAK-1, LnCap, LOXMIVI, LL/2 H460, MDA-MB-231, MDA-MB-435 4A4, MDA-MB-435 2C5, MDA-MB-468, Mel526, MGC803, MIA-Paca 2, MMT 060562, MSTO-211H, MV3, MX-1, NCI-H1299, NCIH1568, NCIH1975, NIH3T3, NPA, NUGC 4, OVCAR-3, OVCAR-5, OVCAR-8, OST, Pan02, PC-3, R40LN, R90L, R90P, SK-BR-3, SW1116, SW480, SL4, SN12C, SOSN2, SH-SY5Y, SK-Hep-1, Sk-mel-5, T24T, T47D, TOV21, U14, U2OS, U87 MG, UM-UC 14, XPAI
    GFP + RFP143 B, B16 F10, DU145, H460, HCT-116, HT 1080, Lewis Lung, MDA-MB-435, MDA-MB-231, MIA-Paca 2, MMT 060562, MV3, PC3, U87 MG, XPAI
    Luciferase ReporterLuciferase4T1, A375, A549, B16F10, CT26.WT, HCT116, HT1080, LL/2, MCF-7, MDA-MB-231, SKOV-3
    Dual ReporterGFP + LuciferaseAGS, HCC70, HT-29, MCF7, NCI-H1299, NCI-H1975, NCI-H661, NCI-N87
    RFP + LuciferaseA549, CNE2Z, GBC-SD, H9C2(2-1), HCT-8, HEK293T, Hep3B, HepG2, HOS, Huh7, Li-7, MDA-MB-231, NCI-H1299, PLC/PRF/5, RBE, SK-HEP-1

    Table 2. Frequently Requested - Inducible Reporter Cell Lines



Commentaires:

  1. Goodwin

    Et que faisons-nous sans vos bonnes idées

  2. Kelrajas

    tu t'es trompé c'est évident

  3. Samurr

    Merci pour l'article

  4. Sebak

    Je suis désolé, mais, à mon avis, ils avaient tort. Je suis capable de le prouver.

  5. Mikio

    Vous ne pouvez même pas vous rendre au fond.

  6. Jerron

    Être en désaccord

  7. Koushik

    C'est tout simplement un thème incomparable :)



Écrire un message