Informations

Quel processus est juste pour décrire la recombinaison V(D)J ? Processus récurrent RAG-1 et RSS

Quel processus est juste pour décrire la recombinaison V(D)J ? Processus récurrent RAG-1 et RSS



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

J'étudie la recombinaison V(D)J. Je pense avoir deux livres incompatibles sur l'explication du processus. Qu'est-ce qui est juste ?

  • Dans Molecular Biology of the Cell 5th Ed., tout d'abord, RAG (-1?) se combine indépendamment aux RSS des gènes V et J. Après cela, une boucle en épingle à cheveux est formatée en associant des RAG aléatoires (?).
  • Dans Janeway's Immunobiology 8th Ed., le complexe RAG (RAG-1 et RAG-2) a deux sites pour les RSS depuis le début. Et sur la figure, le gène V est d'abord recruté pour un site. Le gène J se combine au complexe RAG après le gène V.

Extrait Immunologie cellulaire et moléculaire, 8e ED, p.181-182. Ne me votez pas, je pensais juste que ce texte offrait une bonne explication à jour.

Le mécanisme de recombinaison V(D)J

Le réarrangement des gènes Ig et TCR représente un type particulier d'événement de recombinaison d'ADN non homologue, médié par les activités coordonnées de plusieurs enzymes, dont certaines ne se trouvent que dans les lymphocytes en développement, tandis que d'autres sont une réparation omniprésente des cassures double brin de l'ADN (DSBR) enzymes.Bien que le mécanisme de la recombinaison V(D)J soit assez bien compris et sera décrit ici, comment exactement les loci spécifiques sont rendus accessibles à la machinerie impliquée dans la recombinaison reste à déterminer. Il est probable que l'accessibilité des loci Ig et TCR aux enzymes qui interviennent dans la recombinaison est régulée dans le développement des cellules B et T par plusieurs mécanismes, y compris les altérations épigénétiques de la structure de la chromatine et de l'ADN comme discuté précédemment, et l'activité transcriptionnelle basale dans les loci des gènes. . Le processus de recombinaison V(D)J peut être divisé en quatre événements distincts qui se déroulent séquentiellement de l'un à l'autre (Fig. 8-10) :

1. Synapsis: Des portions du chromosome sur lesquelles se trouve le gène du récepteur antigénique sont rendues accessibles à la machinerie de recombinaison. Deux segments de codage sélectionnés et leurs RSS adjacents sont réunis par un événement de bouclage chromosomique et maintenus en position pour un clivage, un traitement et une jonction ultérieurs.

2. Clivage: Les cassures double brin sont générées par voie enzymatique au niveau des jonctions de séquences codant RSS par une machinerie spécifique aux lymphoïdes. Deux protéines codées par des gènes spécifiques aux lymphoïdes, appelées gène d'activation de la recombinaison 1 et gène d'activation de la recombinaison 2 (RAG1 et RAG2), forment un complexe, contenant deux molécules de chaque protéine, qui joue un rôle essentiel dans la recombinaison V(D)J. Le complexe Rag-1/Rag-2 est également connu sous le nom de recombinase V(D)J. La protéine Rag-1, d'une manière similaire à une endonucléase de restriction, reconnaît la séquence d'ADN à la jonction entre un heptamère et un segment codant et le clive, mais il n'est enzymatiquement actif que lorsqu'il est complexé avec la protéine Rag-2. La protéine Rag-2 peut aider à lier le tétramère Rag-1/Rag-2 à d'autres protéines, y compris les facteurs d'accessibilité qui amènent ces protéines à des loci spécifiques de gènes de récepteurs ouverts à des moments spécifiques et à des stades définis du développement des lymphocytes. Rag-1 et Rag-2 contribuent à maintenir ensemble des segments de gènes pendant le processus de repliement chromosomique ou de synapsis. Rag-1 fait alors une entaille (sur un brin d'ADN) entre l'extrémité codante et l'heptamère. Le 3'OH libéré de l'extrémité codante attaque alors une liaison phosphodiester sur l'autre brin d'ADN, formant une épingle à cheveux covalente. L'extrémité du signal (y compris l'heptamère et le reste du RSS) ne forme pas d'épingle à cheveux et est générée comme une extrémité ADN double brin émoussée qui ne subit aucun autre traitement. Cette rupture double brin a pour résultat qu'une épingle à cheveux fermée d'un segment de codage est maintenue en apposition à l'épingle à cheveux fermée de l'autre extrémité de codage et que deux extrémités de signal de recombinaison émoussées sont placées l'une à côté de l'autre. Rag-1 et Rag-2, en plus de générer les cassures double brin, maintiennent également les extrémités en épingle à cheveux et les extrémités franches ensemble avant la modification des extrémités codantes et le processus de ligature.

Les gènes RAG sont spécifiques des lymphoïdes et ne sont exprimés que dans les cellules B et T en développement. Les protéines Rag sont exprimées principalement dans les stades G0 et G1 du cycle cellulaire et sont inactivées dans les cellules en prolifération. On pense que limiter le clivage et la recombinaison de l'ADN aux stades G 0 et G1 minimise le risque de générer des cassures inappropriées de l'ADN pendant la réplication de l'ADN ou pendant la mitose. Les souris sans Rag1 ou Rag2genes fonctionnels (souris Ragknockout) ne développent pas de lymphocytes B ou T, et le déficit en Rag-1 ou Rag-2 est également une cause rare de SCID, dans laquelle les patients manquent également de tous les lymphocytes.

3. Ouverture en épingle à cheveux et traitement final: Les extrémités de codage cassées sont modifiées par l'ajout ou la suppression de bases, et ainsi une plus grande diversité est générée. Après la formation de cassures double brin, les épingles à cheveux doivent être résolues (ouvertes) au niveau des jonctions codantes, et des bases peuvent être ajoutées ou retirées des extrémités codantes pour assurer une diversification encore plus grande. L'artémise est une endonucléase qui ouvre les épingles à cheveux aux extrémités codantes. En l'absence d'Artemis, les épingles à cheveux ne peuvent pas être ouvertes et les cellules T et B matures ne peuvent pas être générées. Les mutations dans ARTEMIS sont une cause rare de SCID, similaire aux patients avec des mutations RAG1 ou RAG2. (voir chapitre 21). Une enzyme spécifique aux lymphoïdes, appelée désoxynucléotidyl transférase terminale (TdT), ajoute des bases aux extrémités brisées de l'ADN et sera discutée plus loin dans le chapitre dans le contexte de la diversité jonctionnelle.

4. Rejoindre: Les extrémités de codage cassées ainsi que les extrémités de signal sont réunies et ligaturées par un processus de réparation de cassure double brin présent dans toutes les cellules, appelé jonction d'extrémités non homologues. Un certain nombre de facteurs omniprésents participent à la jonction d'extrémités non homologues. Ku70 et Ku80 sont des protéines de liaison terminale de l'ADN qui se lient aux cassures et recrutent la sous-unité catalytique de la protéine kinase dépendante de l'ADN (ADN-PK), une enzyme de réparation de l'ADN double brin. Cette enzyme est défectueuse chez les souris porteuses de la mutation sévère d'immunodéficience combinée (scid), et des mutations dans le gène codant pour cette enzyme ont également été découvertes chez des patients humains SCID (voir chapitre 21). Comme les souris déficientes en Rag, les scidmices ne parviennent pas à produire des lymphocytes matures. L'ADN-PK phosphoryle et active également Artemis, qui, comme mentionné précédemment, est impliqué dans le traitement final. La ligature des extrémités cassées traitées est médiée par l'ADN ligase IV et XRCC4, cette dernière étant une sous-unité non catalytique mais essentielle de la ligase.

Figure 8-10, Immunologie cellulaire et moléculaire, 8e, p182.


Un nouveau dosage quantitatif de rapporteur fluorescent pour les cibles RAG et l'activité RAG


Les gènes d'activation de la recombinaison (RAG) 1 et 2 forment la recombinase spécifique au site qui médie la recombinaison V(D)J, un processus d'édition de l'ADN requis pour le développement des lymphocytes et responsable de leur répertoire diversifié de récepteurs d'antigènes. L'activité RAG mal ciblée s'associe à une altération du génome et est responsable de diverses tumeurs lymphoïdes. De plus, plusieurs tumeurs non lymphoïdes expriment RAG par voie ectopique. Un outil pratique et puissant pour effectuer une évaluation quantitative de l'activité RAG et pour noter les séquences signal de reconnaissance RAG (RSS) putatives est requis dans les domaines de l'immunologie, de l'oncologie, de la thérapie génique et du développement. Nous rapportons ici la caractérisation détaillée d'un nouveau journaliste basé sur la fluorescence de l'activité RAG, nommé GFPi, un outil qui permet de mesurer l'efficacité de recombinaison (RE) par simple analyse par cytométrie en flux. Le GFPi peut être produit à la fois comme plasmide pour des expériences de transfection transitoire dans des lignées cellulaires ou comme rétrovirus pour une intégration stable dans le génome, soutenant ainsi ex vivo et in vivo études. Le test GFPi a fidèlement quantifié l'activité RAG endogène et ectopique testée dans des fibroblastes génétiquement modifiés, des lignées cellulaires dérivées de tumeurs, des cellules pré-B en développement et des cellules hématopoïétiques. Le test GFPi a également réussi à classer le RE de diverses paires RSS, y compris authentique RSS associées à des segments V(D)J, séquences consensus artificielles modifiées ou non au niveau de nucléotides spécifiques connus pour affecter leurs efficacités, ou RSS cryptiques impliquées dans l'activation dépendante de RAG d'oncogènes. Notre travail valide le rapporteur GFPi en tant qu'outil quantitatif pratique pour l'étude de l'activité RAG et de l'efficacité RSS. Il devrait s'avérer utile pour l'étude du V(D)J médié par RAG et des réarrangements aberrants, de l'engagement de la lignée et de l'évolution des vertébrés.


Article de recherche original

Justyna Mika 1 , Sylwia Kabacik 2 , Christophe Badie 2 , Joanna Polanska 1 et Serge M. Candéias 3 *
  • 1 Division de l'exploration de données, Université de technologie de Silésie, Gliwice, Pologne
  • 2 Cancer Mechanisms and Biomarkers Group, Radiation Effects Department, Centre for Radiation, Chemical and Environmental Hazards Public Health England Chilton, Didcot, Royaume-Uni
  • 3 Université Grenoble Alpes, CEA, CNRS, IRIG-LCBM, Grenoble, France

Les gènes codant pour les sous-unités antigéniques du récepteur des cellules T (TR) sont assemblés dans les thymocytes à partir de gènes V, D et J discrets par un processus de recombinaison spécifique au site. Un contrôle strict de cette activité est nécessaire pour éviter des événements de recombinaison potentiellement nuisibles. Les gènes V, D et J sont flanqués de motifs nucléotidiques semi-conservés appelés séquences signal de recombinaison (RSS). La recombinaison V(D)J est initiée par l'introduction précise d'une cassure double brin d'ADN exactement à la frontière des gènes et de leurs RSS par la recombinase RAG. Les RSS sont donc physiquement séparés de la région codante des gènes avant l'assemblage d'un gène TR réarrangé. Au cours d'un profilage à haut débit des gènes TRB chez la souris, nous avons identifié des gènes TRB réarrangés dans lesquels une partie ou la totalité d'un RSS flanquant était conservée dans les articulations codantes V-D ou D-J. Dans certains cas, cette rétention d'ADN de lignée germinale résultait de l'utilisation d'un RSS alternatif en amont. Cependant, nous avons également identifié des séquences TRB où la rétention de l'ADN de la lignée germinale s'est produite en l'absence de RSS alternatif, ce qui suggère que l'activité RAG a été mal ciblée lors de la recombinaison. Des événements similaires ont également été identifiés dans les gènes humains réarrangés TRB et TRG. L'utilisation de RSS alternatifs lors de la recombinaison V(D)J illustre la complexité des interactions RAG-RSS lors de la recombinaison V(D)J. Alors que la fréquence des erreurs résultant d'une activité RAG mal ciblée est très faible, nous pensons que ces erreurs RAG peuvent être à l'origine de translocations oncogènes et constituent une menace pour la stabilité génétique des lymphocytes en développement.


Biochimie du complexe RAG

Le complexe RAG, parfois appelé recombinase V(D)J, est constitué de deux polypeptides, RAG1 et RAG2 [17]. L'expression des protéines RAG1 et RAG2 est limitée dans le développement des cellules B et T, limitant ainsi la recombinaison V(D)J d'une manière spécifique à la lignée et au temps. Depuis la découverte des gènes RAG, une biochimie approfondie du complexe protéique a été menée. RAG1 contient un motif de liaison à l'ADN spécifique à la séquence conservé (motif de liaison nonamère, NBD) et trois acides aminés acides qui coordonnent les cations divalents (motif DDE) nécessaires à la réaction nucléolytique (Fig. 2a) [18]. RAG2 n'a pas d'activité de liaison à l'ADN détectable ou d'activité catalytique en soi, mais l'activité nucléolytique ne devient active que lorsque RAG1 et RAG2 forment un complexe [19]. La protéine de groupe à haute mobilité B1 (HMGB1) et HMGB2 stimulent l'activité de clivage RAG in vitro, mais sa fonction dans la recombinaison V(D)J in vivo est moins claire. Le clivage de l'ADN par le complexe RAG est réalisé par une série d'événements moléculaires (Fig. 2b). Tout d'abord, le complexe RAG reconnaît RSS, puis introduit une entaille à l'extrémité 5′ de chaque 12 ou 23RSS. Le complexe RAG catalyse ensuite la transestérification pour produire des épingles à cheveux d'ADN aux extrémités codantes, entraînant ainsi des DSB. Les DSB se produisent efficacement entre 12/23RSS (synapsis 12/23). Une unité active du complexe RAG consiste en un hétérotétramère comprenant 2 RAG1 et 2 RAG2, cependant, l'ordre cinétique de la réaction RAG n'est pas encore clair [20–22]. Un tétramère RAG peut effectuer l'étape d'entaille à chaque RSS, puis deux tétramères RAG peuvent travailler ensemble pour créer des DSB. Ou un tétramère RAG peut d'abord synapser les deux sites RSS, puis catalyser à la fois l'entaille et la formation de DSB. En raison des limites des essais biochimiques, nous avons utilisé des simulations mathématiques pour trouver des modèles cinétiques qui correspondent aux données cinétiques déterminées expérimentalement d'un essai de clivage in vitro [23]. Sur la base de cette approche, il est prédit qu'un tétramère RAG amène 12RSS et 23RSS dans la synapsis, suivi d'une coupure et d'une épingle à cheveux (Fig. 2b).

Biochimie du complexe RAG. une Modèle du clivage de l'ADN par le complexe RAG. Le complexe RAG se lie et catalyse l'entaille par hydrolyse à chaque RSS dans le complexe synaptique 12/23. Le 3'-OH du brin supérieur attaque le brin inférieur en présence du complexe RAG, entraînant ainsi des cassures d'ADN double brin. Les extrémités codantes forment des épingles à cheveux d'ADN, tandis que les extrémités de signal sont des extrémités franches avec 3'-OH. b Organisation des domaines des protéines RAG murines. La région centrale de RAG1 (a.a. 384–1008) contient un domaine de liaison nonamère (NBD a.a. 389–446), un doigt de zinc B (ZFB a.a. 727–750) et un site actif, le motif DDE (a.a. 600, 708, 962). La région non centrale de RAG1 contient l'annulaire (RING) a.a. 299-330 et doigt de zinc A (ZFA) a.a. 353-374. Région centrale RAG2 (a.a. 1–387) Doigt d'homéodomaine de la plante PHD a.a. 414–481 Site de phosphorylation de T490 par la kinase dépendante de la cycline (left( < ext> ight)_< exte>) , site d'ubiquitylation

Au sein des protéines RAG, les régions nécessaires aux tests de clivage biochimique in vitro et aux tests de recombinaison cellulaire extrachromosomique V(D)J sont appelées core RAG1 et core RAG2 (Fig. 2a) [17]. D'autre part, les régions non centrales des protéines RAG sont nécessaires pour une recombinaison efficace des loci V(D)J génomiques. Il est important de noter que les mutations dans les régions non centrales provoquent le SCID, mais leurs fonctions ne sont pas bien comprises [24]. L'extrémité RAG1 N dans la région non centrale contient un domaine RING finger qui possède une activité ubiquitine ligase (E3) elle-même ou lorsqu'elle est en complexe avec les protéines VprBP/DDB1/Cul4A/Roc1 [25-27]. Il a été rapporté que cette région se lie et ubiquitine l'histone H3, reliant peut-être le complexe RAG au processus de réparation DSB. La région non centrale RAG2 dans l'extrémité C-terminale joue un rôle dans l'instabilité du génome en contribuant à la discrimination de la spécificité de séquence [28-30]. Cette région contient également un site de phosphorylation pour la cycline A-Cdk2 à Thr490 et un doigt PHD [31]. Thr490 et l'intervalle couvrant les acides aminés 499 à 508 sont liés à la destruction périodique de RAG2 dans la transition G1-S par une polyubiquitylation dépendante de Skp1-Cul1-Skp2 (Skp2-SCF) [32, 33]. Étant donné que la recombinaison V(D)J se produit en phase G1, la destruction de la protéine RAG peut fonctionner pour empêcher une activité RAG aberrante en dehors de G1. Le doigt RAG2 PHD se lie spécifiquement à l'histone H3 lysine4 hyperméthylée, contribuant ainsi à la formation efficace de DSB, dont nous discuterons plus tard dans cette revue [10–13].


Résultats

Génération et caractérisation d'une souche de souris permettant l'inactivation conditionnelle de RAG-2.

La stratégie de ciblage génique et le criblage de cellules ES recombinantes par transfert de Southern sont présentés sur la figure 1A et la figure B, respectivement. Le conditionnel RAG-2 allèle (RAG-2 fl ) a été transmis dans la lignée germinale C57BL/6 et les souris mutantes ont été analysées. Lympopoïèse des lymphocytes B dans la BM de RAG-2 Les souris fl/fl étaient normales et la taille du pool de cellules B périphérique était comparable à celle des souris de type sauvage, ce qui n'indique aucune interférence avec RAG-2 expression par l'insertion des deux loxP sites (données non présentées). Pour générer des souris homozygotes pour RAG-2 suppression (RAG-2 del/del ), RAG-2 des souris fl/fl ont été croisées avec suppression souche, qui permet la suppression ubiquitaire de loxP-segments de gènes flanqués comprenant des cellules germinales 37. Développement des cellules B et T dans RAG-2 del/del a été bloqué aux stades pro-B et pro-T, produisant le phénotype de RAG-1 et RAG-2 souris knock-out (29,30 données non présentées).

Souris du génotype RAG-2 fl/del , Mx-cre, dans lequel RAG-2 la suppression peut être efficacement induite par l'IFN ou son inducteur, Poly(I)·Poly(C) 34, ont été utilisés dans nos autres expériences. 2 semaines après l'injection intrapéritonéale de Poly(I)·Poly(C) chez un adulte RAG-2 fl/del, souris Mx-cre, un peu moins de cellules BM ont été récupérées chez ces animaux que chez les témoins de la même portée traités de manière similaire. Gating sur la population IgM-négative, le compartiment des cellules B220 low CD43 + pro-B chez les animaux de laboratoire était comparable à celui des témoins, tandis que les cellules B220 low CD43 − pré-B étaient essentiellement absentes, indiquant un blocage du développement des cellules B au stade pro-cellule B (Fig. 1 C). B220 faible IgM + cellules B immatures étaient à des niveaux de fond, tandis que B220 haute IgM + cellules B matures n'étaient pas affectées. Semblable au développement des cellules B dans la BM, le développement des cellules T dans le thymus a été bloqué au stade des cellules pro-T lors de l'induction de RAG-2 suppression (données non présentées). En accord avec la courte durée de vie des cellules B immatures 12,14, le compartiment élevé des cellules B immatures IgM + HSA dans la rate des mutants traités par Poly(I)·Poly(C) a été réduit aux niveaux de fond (voir Fig. 1 C les quelques cellules à haute teneur en IgM + HSA dans la rate des mutants étaient principalement des cellules CD21 + et donc vraisemblablement des cellules MZ B). Comme chez les souris adultes, le développement des cellules B a également été bloqué au stade pro-cellules B chez les souris chez lesquelles RAG-2 a été supprimée à la naissance ou à l'âge de 2 semaines (données non présentées). Chez ces souris ainsi que chez celles traitées avec l'inducteur à l'âge adulte, le blocage du développement des cellules B tel que représenté sur la figure 1C a été maintenu pendant toute la période d'observation (voir ci-dessous les données non présentées). L'efficacité de suppression du RAG-2 fl dans le BM tel que quantifié par l'analyse par transfert de Southern était proche de 100 % à la fois chez les adultes et les nouveau-nés, alors qu'il était 90 % dans la rate et les cellules de la cavité péritonéale (données non présentées).

Pour vérifier que le bloc induit du développement des cellules B était bien complet, nous avons reconstitué des syngéniques irradiés de manière sublétale. RAG-1 −/ − souris (qui manquent de cellules B et T) avec des cellules BM de 13 semaines RAG-2 fl/del , souris Mx-cre qui avaient été traitées avec Poly(I)·Poly(C) à l'âge de 8 semaines. Cellules BM provenant d'un traitement similaire RAG-2 les souris fl/del ont servi de contrôle. Le nombre total de cellules spléniques récupérées 4 semaines après le transfert était de 2,8 × 10 6 chez les receveurs reconstitués avec de la BM à partir de Poly(I)·Poly(C) traité RAG-2 fl/del, souris Mx-cre et 2,2 × 10 7 chez les témoins. Comme le montre la figure 1 D, les souris qui avaient reçu des cellules BM des mutants induits n'ont présenté aucune reconstitution détectable pour les cellules B, alors que les témoins étaient entièrement reconstitués. Des résultats similaires ont été obtenus en utilisant des cellules BM de souris donneuses de 19 semaines dans lesquelles RAG-2 avait été inactivé à la naissance (données non présentées). Dans les deux expériences de reconstitution, les cellules BM de deux souris donneuses ont été testées individuellement. Dans tous les cas, le donateur dérivé RAG-2 la délétion a pu être détectée par PCR dans la BM et la rate des receveurs, indiquant que les cellules donneuses avaient été acceptées par ces derniers (données non présentées).

Déclin lent et persistance ultérieure des cellules B périphériques chez les souris adultes lors du blocage induit de l'afflux de cellules B à partir de la BM.

La cinétique de survie des cellules B dans la rate, les ganglions lymphatiques et la BM en l'absence de nouveaux immigrants de la BM a été suivie chez des souris chez lesquelles RAG-2 a été supprimée à l'âge de 8-10 semaines. Par rapport aux témoins, la taille du pool de cellules B dans la rate de RAG-2 fl/del , les souris Mx-cre ont été réduites de 67 % à la semaine 2 (à laquelle les cellules immatures avaient disparu [Fig. 1 C]) à 32 % à la semaine 17 après l'injection de Poly(I)·Poly(C) et par la suite est resté stable jusqu'à 54 semaines (Fig. 2 A). Dans les ganglions lymphatiques, le nombre de cellules B220 + IgD + B n'a pas diminué au cours des 2 premières semaines, et a diminué par la suite, avec une chute rapide du nombre de cellules (de 58 à 11% des témoins) entre la semaine 10 et la semaine 17 après avoir induit RAG-2 suppression (Fig. 2 B). Il n'y a pas eu de réduction supplémentaire du nombre de lymphocytes B dans les ganglions lymphatiques entre 17 et 54 semaines. Comme le montre la figure 2 C, la taille du pool de cellules B à haute teneur en IgM + matures B220 dans la BM a été réduite de moitié par rapport aux témoins 2 semaines après l'injection de Poly(I)·Poly(C), et a ensuite diminué lentement. sur la période d'observation, avec une demi-vie de 156 j. Comme dans la rate, la réduction du nombre de cellules B au cours des 2 premières semaines était principalement due à la perte de cellules B à haute teneur en HSA. Dans l'ensemble, le nombre total de cellules B dans les organes lymphoïdes secondaires de souris adultes en l'absence d'afflux de cellules B de la BM a diminué au cours des 17 premières semaines et s'est ensuite maintenu jusqu'à 54 semaines. En revanche, les nombres de cellules IgM + CD5 + B-la dans la cavité péritonéale des mutants étaient comparables à ceux des témoins (données non présentées).

Déclin des cellules FO B et maintien des cellules MZ B après la suppression de RAG-2 chez les adultes.

Les cellules MZ B se distinguent des cellules FO B en recirculation par leur localisation anatomique et leurs caractéristiques phénotypiques. Selon les niveaux d'expression de CD21 et CD23, nous avons divisé les cellules B spléniques en cellules B MZ (CD21 high CD23 low ) et FO (CD21 int CD23 high ) et avons suivi leur nombre après induction de RAG-2 suppression chez la souris adulte. Comme le montre la figure 3A, la proportion de cellules MZ B au sein de la population de cellules IgM-positives de surface est passée de moins de 10 % à 17 % à la semaine 2 et ∼ 40 % à la semaine 31 après RAG-2 suppression, alors qu'elle était constante dans les contrôles sur la même période de temps. En termes de nombre de cellules, le pool de cellules MZ B dans la rate des animaux de laboratoire était comparable à celui des témoins et stable sur 54 semaines (Fig. 3 B). En revanche, le nombre de cellules FO B a diminué lentement, avec une demi-vie calculée de 134 jours (Fig. 3 B) et donc en accord raisonnable avec le déclin des cellules B en recirculation dans la BM (Fig. 2 C).

Lorsque le développement des cellules B est bloqué à la naissance, un petit nombre de cellules B est maintenu, avec une population élargie de cellules B-1 dans la cavité péritonéale et de cellules MZ B dans la rate.

Dans quelle mesure les cellules B immatures présentes chez les souris nouveau-nées peuvent-elles construire un compartiment de cellules B périphérique en l'absence d'afflux de cellules B de la BM ? Lorsque RAG-2 a été supprimée chez les nouveau-nés par injection d'IFN, les animaux ont maintenu une petite population de cellules B dans la rate et les ganglions lymphatiques sur de longues périodes de temps, mais le nombre de cellules B était bien inférieur à celui développé chez les témoins (Fig. 2D et Fig. E) . En revanche, le développement des cellules B-1a (IgM + CD5 + ) dans la cavité péritonéale n'était pas perturbé, et à partir de la semaine 8 après l'injection d'IFN, 2 à 3 fois plus de ces cellules ont été récupérées chez les animaux que chez les témoins (Fig. 2F). Ainsi, le blocage de la génération de cellules B à la naissance n'a pas perturbé le développement et l'expansion des cellules B-1a, un résultat qui est conforme aux résultats antérieurs montrant que les cellules B1 sont des cellules auto-renouvelables 5.

La MZ chez la souris ne se développe généralement pas avant 3 semaines à l'âge de 38 ans. Toutes les cellules B spléniques des souris nouveau-nées expriment des niveaux élevés de HSA et ont un phénotype immature (données non présentées). nous avons induit RAG-2 délétion chez des souris nouveau-nées par injection d'IFN et a demandé si les cellules B dans la rate de ces animaux se différencieraient en cellules MZ B en l'absence d'afflux de cellules B en provenance de la BM. Étonnamment, certaines cellules B ont acquis un phénotype de cellule MZ B et d'autres un phénotype de cellule FO B déjà 2 semaines après RAG-2 suppression, qui était moins évidente dans les contrôles appariés selon l'âge (Fig. 3 C). Le pourcentage de cellules MZ B au sein de la population de cellules IgM-positives de surface était ∼ 25 % de la semaine 4 à la semaine 28 après RAG-2 suppression (Fig. 3C). En termes de nombre de cellules, les cellules MZ B dans le RAG-2–les mutants déficients ont légèrement augmenté au fil du temps, passant de ∼8 × 10 5 à la semaine 4 à 2 × 10 6 à la semaine 28 après RAG-2 suppression (Fig. 3D). Les cellules FO B se développant chez les animaux (Fig. 3 C) sont restées constantes en nombre au cours du temps (Fig. 3 D). En dehors des cellules MZ et FO B, des cellules CD5+ B ont pu être détectées dans la rate des animaux, représentant 30 à 50 % des cellules IgM+ ou CD19+. En nombres absolus, cela correspond au compartiment des cellules CD5 + B (cellules B-1a) dans la rate des témoins (données non présentées mais voir Fig. 3 C, panneau inférieur).

L'augmentation relative du pool de cellules MZ B observée par cytométrie en flux était également évidente au niveau de l'histologie. À l'âge de 8-10 semaines, une augmentation des cellules MZ B et une diminution des cellules FO B ont pu être observées dans les coupes histologiques de la rate chez les mutants, par rapport aux témoins (Fig. 4).

Les cellules B périphériques chez les souris chez lesquelles le développement des cellules B a été bloqué à la naissance acquièrent un phénotype activé et ont une activité proliférative.

La petite population de cellules B maintenue dans la rate des animaux chez lesquels le développement des cellules B a été bloqué à la naissance n'est pas seulement inhabituelle en ce qui concerne leur tendance à se développer en cellules MZ B. Ces cellules avaient également une taille accrue et présentaient une régulation à la hausse des marqueurs d'activation tels que CD25, CD69, CD86 et MHC classe II lorsqu'elles étaient analysées à l'âge de 8 semaines (Fig. 5). Les cellules activées, indépendamment du phénotype MZ ou FO, présentaient une activité proliférative substantielle, avec 10 % des cellules MZ B et 7 % des cellules FO B incorporant BrdU après une période de marquage de 3 jours, contre 16 et 11 % chez les témoins (dans lequel il y a un afflux de cellules B nouvellement générées du BM Fig. 6 A). Une analyse des cellules pour la teneur en ADN a montré que jusqu'à 1% des cellules étaient dans la phase S ou G2/M du cycle cellulaire (Fig. 6 A). Ces données suggèrent qu'une fraction substantielle des cellules B maintenues chez ces animaux dans la rate et les ganglions lymphatiques subissent un auto-renouvellement. Cependant, toutes les cellules ne peuvent pas participer à cette activité d'auto-renouvellement, car l'administration de BrdU pendant une période de 3 semaines a entraîné le marquage d'au plus un quart des cellules (données non présentées).

La situation était assez différente chez les souris chez lesquelles le développement des cellules B avait été bloqué à l'âge de 8 semaines. Lorsque ces animaux ont été nourris avec BrdU dans l'eau de boisson pendant 3 jours, 10 semaines après l'application de Poly(I)·Poly(C), seulement 1 % des cellules FO B et 2 % des cellules MZ B ont été marquées, comparativement avec 2 et 3%, respectivement, dans les contrôles (Fig. 6 B). Selon la teneur en ADN, encore environ 1% des cellules étaient en phase S ou G2/M du cycle cellulaire (Fig. 6 B). Il est possible que chez ces animaux, les cellules B restantes n'acquièrent une activité d'auto-renouvellement complète que plus tard, lorsque le nombre de cellules a chuté à un niveau comparable à celui observé chez les animaux chez lesquels le développement des cellules B a été bloqué à un stade précoce. En accord avec cette possibilité, lorsque RAG-2 la délétion a été induite chez des souris adultes, la cellule B a acquis un phénotype activé comme celui représenté sur la figure 5 seulement environ 4 mois plus tard (données non présentées).

La délétion de RAG-2 induite à la naissance entraîne une augmentation des taux sériques d'IgM et du nombre de cellules sécrétrices d'IgM.

Le nombre de cellules B chez les animaux dans lesquels RAG-2 a été supprimée à la naissance est inférieure à 10 % des témoins (Fig. 2D et Fig. E). Pourtant, à l'âge de 8 et 17 semaines, les taux d'immunoglobulines sériques chez ces souris étaient proches, et parfois même supérieurs, à ceux des témoins (Fig. 7A et Fig. B). Pour comprendre ce phénomène, nous avons utilisé ELISPOT pour déterminer le nombre de cellules sécrétrices d'IgM et d'IgG3 dans la rate et la BM des souris à l'âge de 8 semaines. Comme le montre la figure 7 C, le nombre total de cellules sécrétrices d'IgM était de trois à quatre fois plus important dans la phase induite. RAG-2 mutants que chez les témoins, et les animaux hébergeaient également un nombre substantiel de cellules sécrétrices d'IgG3. Les cellules sécrétrices d'anticorps peuvent très bien dériver en grande partie de cellules B-1 qui sont présentes chez ces animaux en nombre normal et connues pour contribuer de manière significative à la production d'IgM 39.


Le déplacement le plus important pour les cellules homogènes modélisées par les gens variait de 2 à 4 m, ce qui est comparable aux tailles rapportées de vacuoles géantes (Tripathi 1972)

Le déplacement le plus important pour les cellules homogènes modélisées par les gens variait de 2 à 4 m, ce qui est comparable aux tailles rapportées de vacuoles géantes (Tripathi 1972). possèdent des attachements substantiels avec leur substratum depuis leur périphérie. Cela impose des limites à la résistance au mouvement que le revêtement peut générer, ce qui inclut des implications concernant le site Web où la quasi-totalité de la résistance au mouvement peut être générée dans un œil sain et glaucomateux. schéma de la section antérieure de l'œil affichant le chemin du mouvement du rire aqueux dans l'élargissement de la position de l'irisCcornea , grandes vacuoles JCT, cellules conjonctives juxtacanaliculaires (Overby et al. 2014) Les cellules du canal de Schlemms sont à la merci de l'alpha-Amanitine d'un environnement biomécanique relativement exclusif Contrairement aux cellules endothéliales vasculaires soumises à un gradient de pression apicale à basale qui est soutenu par leur membrane basale, les cellules SC sont à la merci d'un gradient de pression baso-apical qui pousse les cellules de leur membrane basale auxiliaire.En conséquence, les cellules SC subissent de grandes déformations et créent des constructions connues sous le nom de grandes vacuoles Johnson 2001 Grierson et Lee 1977) on pense que ces déformations entraînent le développement de pores dans ces cellules, par lequel le rire aqueux bouge (Ethier et al. 1998 Johnson et al. alpha-Amanitine 1990). Comme la densité des pores continue d'être observée pour devenir faible en alpha-Amanitine dans l'œil glaucomateux (Allingham et al. 1992 Johnson et al. 2002), il est nécessaire de mieux comprendre la biomécanique de la structure de la paroi interne du SC. Ici, nous décrivons RAC2 l'utilisation de la microscopie électronique à balayage en bloc (SBSEM) et de la modélisation en composantes finies (FEM) couplée à des mesures de microscopie à poussée atomique (AFM) à partir du module des cellules SC (Vargas-Pinto et al. 2013) pour caractériser les conséquences de la géométrie des cellules, de l'étanchéité des cellules, ainsi que de la contribution du cortex cellulaire à la déformation générée par la pression des cellules SC, nous calculons la chute de pression maximale que ces cellules peuvent également supporter. En créant cette partie supérieure destinée, nous sommes en mesure de déterminer si l'endothélium de la structure de la paroi interne du SC pourrait être raisonnablement supposé aider une petite fraction significative de la chute de pression complète sur la voie d'écoulement régulière. 2 Stratégies 2.1 Imagerie des cellules SC Deux donneurs d'œil humains sans antécédents connus de maladie oculaire (âgés de 69 et 70 ans) ont été reçus du Country wide Disease Study Interchange (Philadelphie, PA) dans les 24 h post-mortem. Des échantillons de tissus radiaux et frontaux du réseau trabéculaire ont été fixés et coupés avec 2,5 % de glutaraldéhyde et 4 % de paraformaldéhyde à l'intérieur d'un tampon cacodylate de sodium 0,1 M. Les tissus fixés avaient été colorés avec de l'acidité tannique et colorés avec du ferrocyanure d'osmium, accompagnés d'un traitement au tétracarbohydrazide, et ensuite colorés avec du tétroxyde d'osmium aqueux. Les cellules ont ensuite été incubées dans de l'acétate d'uranyle aqueux saturé, accompagnées d'aspartate de plomb commercial de Waltons (Deerinck et al. 2010). Troisièmement, les tissus avaient été déshydratés et incrustés d'Epon. SBSEM picture data sets had been obtained at Renovo Neural Inc. (Cleveland, OH). An example image is provided in Online Source 1. The cells blocks were installed, analyzed, and sectioned inside a Zeiss Sigma VP checking electron microscope built with a Gatan 3View in-chamber ultramicrotome stage with low-kV backscattered electron detectors optimized for 3View systems. The internal wall structure endothelium of SC in each test stop was initially determined, and the parts of curiosity were chosen to add small part of lumen of SC, internal wall structure endothelium of SC, as well as the root JCT. The first sample block was sectioned along the much longer axis of SC longitudinally. Some 500 EM pictures inside a field size of 204.80 61.40 m were acquired at 2.25 kV with an answer of 10 nm per pixel and 100 nm per cut. Five internal wall structure endothelial cells had been captured out of this data arranged. However, because of the great cell size, the limited field size could just catch one endothelial cell (SC04), as the other four cells were out of field partially. To make sure catch of the entire amount of SC cells while preserving very similar field quality and size, cross areas along the shorter axis of SC had been cut in the next sample stop. Each image attained from this stop demonstrated a transverse watch from the cell. Some 1001 EM pictures within a field size of 53.30 31.98 m.


Raw NGS sequencing data analyzed with a custom analysis pipeline, available from the docker hub repository at hub.docker.com under kamhonhoi/iganalysis. Principal Component Analysis performed using the ‘princomp’ function and Repertoire Similarity Index, implemented using the ‘sdists’ function in the package ‘cba’ in R version 3.5.0.

Schroeder, H. W. Jr. & Cavacini, L. Structure and function of immunoglobulins. J. Allergie Clin. Immunol. 125, S41–S52 (2010).

Cobb, R. M., Oestreich, K. J., Osipovich, O. A. & Oltz, E. M. Accessibility control of V(D)J recombination. Av. Immunol. 91, 45–109 (2006).

Bassing, C. H., Swat, W. & Alt, F. W. The mechanism and regulation of chromosomal V(D)J recombination. Cellule 109(Suppl), S45–S55 (2002).

Rajewsky, K. Clonal selection and learning in the antibody system. La nature 381, 751–758 (1996).

Nemazee, D. Mechanisms of central tolerance for B cells. Nat. Rév. Immunol. 17, 281–294 (2017).

Zemlin, M. et al. Expressed murine and human CDR-H3 intervals of equal length exhibit distinct repertoires that differ in their amino acid composition and predicted range of structures. J. Mol. Biol. 334, 733–749 (2003).

Schroeder, H. W. Jr. Similarity and divergence in the development and expression of the mouse and human antibody repertoires. Dév. Comp. Immunol. 30, 119–135 (2006).

Bagnara, D. et al. A reassessment of IgM memory subsets in humans. J. Immunol. 195, 3716–3724 (2015).

Wardemann, H. et al. Predominant autoantibody production by early human B cell precursors. Science 301, 1374–1377 (2003).

Wu, Y. C. et al. High-throughput immunoglobulin repertoire analysis distinguishes between human IgM memory and switched memory B-cell populations. Du sang 116, 1070–1078 (2010).

Roskin, K. M. et al. IgH sequences in common variable immune deficiency reveal altered B cell development and selection. Sci. Trad. Méd. 7, 302ra135 (2015).

Doorenspleet, M. E. et al. Rheumatoid arthritis synovial tissue harbours dominant B-cell and plasma-cell clones associated with autoreactivity. Anne. Rhume. Dis. 73, 756–762 (2014).

Bashford-Rogers, R. J. M., Smith, K. G. C. & Thomas, D. C. Antibody repertoire analysis in polygenic autoimmune diseases. Immunologie 155, 3–17 (2018).

DeKosky, B. J. et al. Large-scale sequence and structural comparisons of human naive and antigen-experienced antibody repertoires. Proc. Natl Acad. Sci. Etats-Unis 113, E2636–E2645 (2016).

Ivanov, I. I. et al. Development of the expressed Ig CDR-H3 repertoire is marked by focusing of constraints in length, amino acid use, and charge that are first established in early B cell progenitors. J. Immunol. 174, 7773–7780 (2005).

Larimore, K., McCormick, M. W., Robins, H. S. & Greenberg, P. D. Shaping of human germline IgH repertoires revealed by deep sequencing. J. Immunol. 189, 3221–3230 (2012).

Elhanati, Y. et al. Inferring processes underlying B-cell repertoire diversity. Philos. Trans. R. Soc. Londres. B Biol. Sci. 370, 20140243, https://doi.org/10.1098/rstb.2014.0243 (2015).

Miqueu, P. et al. Statistical analysis of CDR3 length distributions for the assessment of T and B cell repertoire biases. Mol. Immunol. 44, 1057–1064 (2007).

Marcou, Q., Mora, T. & Walczak, A. M. High-throughput immune repertoire analysis with IGoR. Nat. Commun. 9, 561 (2018).

Briney, B., Inderbitzin, A., Joyce, C. & Burton, D. R. Commonality despite exceptional diversity in the baseline human antibody repertoire. La nature 566, 393–397 (2019).

Goldstein, L. D. et al. Massively parallel single-cell B-cell receptor sequencing enables rapid discovery of diverse antigen-reactive antibodies. Commun. Biol. 2, 304 (2019).

Laserson, U. et al. High-resolution antibody dynamics of vaccine-induced immune responses. Proc. Natl Acad. Sci. Etats-Unis 111, 4928–4933 (2014).

DeKosky, B. J. et al. In-depth determination and analysis of the human paired heavy- and light-chain antibody repertoire. Nat. Méd. 21, 86–91 (2015).

Busse, C. Dynamics of the human antibody repertoire after influenza vaccination. NCBI BioProject Database, https://www.ncbi.nlm.nih.gov/bioproject/PRJNA349143 (2016).

DeWitt, W. S. et al. A public database of memory and naive B-cell receptor sequences. PLoS UN 11, e0160853 (2016).

Lefranc, M. P. IMGT, the international ImMunoGeneTics database: a high-quality information system for comparative immunogenetics and immunology. Dév. Comp. Immunol. 26, 697–705 (2002).

Greiff, V. et al. Systems analysis reveals high genetic and antigen-driven predetermination of antibody repertoires throughout B cell development. Cellule Rep. 19, 1467–1478 (2017).

Matsutani, T. et al. Comparison of CDR3 length among thymocyte subpopulations: impacts of MHC and BV segment on the CDR3 shortening. Mol. Immunol. 44, 2378–2387 (2007).

Miho, E., Roskar, R., Greiff, V. & Reddy, S. T. Large-scale network analysis reveals the sequence space architecture of antibody repertoires. Nat. Commun. 10, 1321 (2019).

Boyd, S. D. et al. Individual variation in the germline Ig gene repertoire inferred from variable region gene rearrangements. J. Immunol. 184, 6986–6992 (2010).

Kidd, M. J. et al. The inference of phased haplotypes for the immunoglobulin H chain V region gene loci by analysis of VDJ gene rearrangements. J. Immunol. 188, 1333–1340 (2012).

Gidoni, M. et al. Mosaic deletion patterns of the human antibody heavy chain gene locus shown by Bayesian haplotyping. Nat. Commun. 10, 628 (2019).

Shirai, H., Kidera, A. & Nakamura, H. H3-rules: identification of CDR-H3 structures in antibodies. FEBS Lett. 455, 188–197 (1999).

North, B., Lehmann, A. & Dunbrack, R. L. Jr. A new clustering of antibody CDR loop conformations. J. Mol. Biol. 406, 228–256 (2011).

Weitzner, B. D., Dunbrack, R. L. Jr. & Gray, J. J. The origin of CDR H3 structural diversity. Structure 23, 302–311 (2015).

Vander Heiden, J. A. et al. Dysregulation of B cell repertoire formation in Myasthenia Gravis patients revealed through deep sequencing. J. Immunol. 198, 1460–1473 (2017).

Jain, T. et al. Biophysical properties of the clinical-stage antibody landscape. Proc. Natl Acad. Sci. Etats-Unis 114, 944–949 (2017).

Collis, A. V., Brouwer, A. P. & Martin, A. C. Analysis of the antigen combining site: correlations between length and sequence composition of the hypervariable loops and the nature of the antigen. J. Mol. Biol. 325, 337–354 (2003).

Breden, F. et al. Comparison of antibody repertoires produced by HIV-1 infection, other chronic and acute infections, and systemic autoimmune disease. PLoS UN 6, e16857 (2011).

Magoc, T. & Salzberg, S. L. FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatique 27, 2957–2963 (2011).

Chen, Y. et al. Barcoded sequencing workflow for high throughput digitization of hybridoma antibody variable domain sequences. J. Immunol. Méthodes 455, 88–94 (2018).

Ye, J., Ma, N., Madden, T. L. & Ostell, J. M. IgBLAST: an immunoglobulin variable domain sequence analysis tool. Acides nucléiques Res. 41, W34–W40 (2013).

Sankar, K., Hoi, K. H., Jr. & Hotzel, I. Dynamics of heavy chain junctional length biases in antibody repertoires. Dryad Database, https://doi.org/10.5061/dryad.cjsxksn5062x (2020).


Introduction

In mouse and man, B cells are continuously generated from B cell progenitors over lifetime, with the fetal liver and, from around birth on, the bone marrow (BM) as the main sites where this process takes place. The immature B cells generated in the BM emigrate into the peripheral immune system and give rise to a heterogeneous population of peripheral B cells including naive, memory and plasma cells 1. In terms of their anatomical location and surface markers, the B cell population in the periphery consists of recirculating IgM low IgD high CD21 int CD23 high cells located in follicles in spleen and lymph nodes, and IgM high IgD low CD21 high CD23 low non-recirculating cells enriched mainly in the marginal zone (MZ) of the spleen 2,3. Follicular (FO) B cells in the spleen account for 80–90% and MZ B cells for 5–10% of the splenic B cells in an adult mouse 4. Another B cell subset, consisting of the so-called B-1 cells, has self-renewing capacity and predominates in the peritoneal and pleural cavities 5. Recent data on the function of MZ B cells 6,7,8 and B-1 cells 9,10 suggest that these cells provide a first line of defense against antigens in the blood, and in the peritoneal and pleural cavities, respectively. FO B cells are involved in T cell–dependent antibody responses, in which memory and plasma cells are generated 7.

About 1–2 × 10 7 immature B cells are generated daily in the adult murine BM 11. Of these, only 3% enter the pool of mature B cells of the various subsets 12. Peripheral B cell pools represent dynamic, yet stable compartments where the input contributed by BM immigrants and antigen driven cell proliferation is balanced by apoptosis and terminal differentiation 13.

For an understanding of this homeostatic control it is of critical importance to determine the life spans of B cells of various subsets under physiological conditions. It is therefore not surprising that B cell life spans have been the subject of many investigations in the past. However, while it is generally agreed that newly generated immature B cells in adult mice have life spans of ∼3-4 d 12,14, the life spans of mature B cells are still controversial. Experiments based on (a) adoptive transfer of LPS-reactive B cells into LPS-nonreactive recipient mice 15 (b) the ablation of cycling B cell precursors with cytotoxic drugs which selectively kill cycling cells 16,17 and (c) induction of BM aplasia using a radioactive strontium isotope, 89 S 18 support the hypothesis that most mature B cells have a life span of just a few days 13. In contrast, experiments in which B cell development was blocked by anti–IL-7 19, or anti–IL-7 receptor antibodies 20 or cells were labeled by [ 3 H]thymidine 21,22,23 or bromo deoxyuridine (BrdU) in vivo 24,25,26 lead to the conclusion that the majority of splenic B cells can persist for several weeks or months.

To further clarify this matter and to extend the analysis to the various subsets of mature B cells, we have now generated a transgenic mouse strain in which B cell development can be blocked permanently at any stage of development under quasi-physiological conditions. To achieve this goal we made use of the fact that both B and T cell development critically depend on the somatic assembly of Ig or T cell receptor variable region gene segments, called V, D, and J, by a process known as V(D)J recombination 27. V(D)J recombination is mediated by the products of the recombination-activating genes RAG-1 et RAG-2 28. Consequently, in RAG-1– ou RAG-2–deficient mice B and T cell development are blocked at an early progenitor stage 29,30. Induced inactivation of RAG-1 ou RAG-2 in B and T cell progenitors in the BM can thus be expected to lead to a block in B and T cell generation. Using conditional gene targeting 31, we established a transgenic mouse strain in which RAG-2 can be inducibly and efficiently inactivated whenever desired. In the present paper, we describe this experimental system and use it to study the maintenance and differentiation of the various peripheral B cell subsets in intact, healthy animals, in the absence of B cell influx from the BM, i.e., a situation in which B cell life spans should be maximized.


Materials And Methods

Isolation of Thymocytes.

Methods for maintenance of SCID-hu mice and harvest of thymocytes from SCID-hu Thy/Liv organs were identical to those previously published 17. In some cases, SCID-hu Thy/Liv organs were harvested and placed in RPMI 1640 media (Life Technologies) supplemented with 10% FCS (Summit Biotechnology) and transported overnight at 4°C before harvest of thymocytes. After isolation, thymocytes were resuspended in PBS supplemented with 2% FCS and kept on ice before staining with mAbs for flow cytometric analysis or cell sorting. All procedures and practices were approved by the University of California, San Francisco Committee on Human Research (CHR) or Committee on Animal Research.

Isolation of PBMCs.

Whole blood samples from human subjects were collected by phlebotomy into EDTA collection tubes (Becton Dickinson). PBMCs were isolated from whole blood by density–gradient centrifugation (Life Technologies). PBMCs were washed twice with PBS before resuspension in PBS supplemented with 2% FCS before staining with mAbs for flow cytometry or cell sorting.

Stimulation of Cord Blood Cells In Vitro.

Human umbilical cord blood cells were obtained (with CHR approval) from healthy delivery specimens and placed in heparinized collection tubes (Becton Dickinson) under sterile conditions. Cord blood mononuclear cells (CBMCs) were isolated as described above for whole blood specimens and resuspended at a concentration of 2 × 10 6 cells/ml in RPMI 1640 supplemented with 10% human AB serum (Ultraserum Gemini Bio-Products). CBMCs were then cultured (at 37°C in 5% CO2) for 48, 72, or 96 h or 9 d (time points encompassed in two different experiments) and stimulated with 5 μg/ml of PHA (Sigma Chemical Co.) and 10 U/ml purified IL-2 (Boehringer Mannheim). The supplemented medium was changed every 3 d. Cell culture controls did not receive PHA or IL-2 stimulation but were cultured for 72 h in the same medium. Aliquots of the cell cultures at different time points were analyzed by flow cytometry for the expression of the cell surface markers CD45RA and CD62L.

Immunophenotypic Analysis and Cell Sorting by Flow Cytometry.

PBMCs, thymocytes from SCID-hu mice, or CBMCs were stained with fluorescent-conjugated mABs specific for cell surface markers at a concentration of 10 7 cells/ml at 4°C for 30 min. After staining, cells were washed with PBS supplemented with 2% FCS and sorted on either a FACStar™ or FACS Vantage™ cell sorter (both from Becton Dickinson). The cells were stained with one of the following antibody combinations: (a) anti-CD8–FITC and anti-CD4–PE (Becton Dickinson) (b) anti-CD45RA–FITC or anti-CD45RO–FITC (Immunotech), anti-CD62L–PE (Becton Dickinson), and anti-CD4–ECD (Coulter Immunology) (c) anti-CD62L–FITC, anti-CD45RA–PE (PharMingen), and anti-CD4–tricolor or anti-CD4–allophycocyanin (Caltag Labs., Inc.). Sort purities were checked after each sort and were ≥97%. For analysis of cord blood CD45RA and CD62L expression, CBMCs were stained with anti-CD45RA–FITC (Immunotech) and anti-62L–PE (Becton Dickinson) and analyzed using a FACScan™ cytometer and CELLQuest™ software (both from Becton Dickinson).

Detection of TCR-β Rearrangement Deletion Circles.

Total DNA from distinct cell populations was extracted and purified via a standard protocol 18 before spectrophotometric quantitation at 260 and 280 nm. The freshly isolated DNA was stored at 4°C for further processing. Thermal cycling was performed for 30 cycles (1 min at 94°C, 1.5 min at 65°C, and 1.5 min at 72°C) for each round of a seminested PCR protocol designed to detect VβDβ-specific deletion circles (DCs) generated by TCR-β recombination. All first and second round primers were generated to fully hybridize with noncoding regions of the TCR-β locus 19 located next to the recombination signal sequences (RSS available from EMBL/GenBank/DDBJ under accession numbers U66059, U66060, and U66061 see Table). Four PCR replicates were performed on each total DNA serial dilution to ensure a precise readout for each experiment. Concentrations of total DNA were adjusted so that a constant volume of 3 μl was added to each 50-μl PCR reaction (200 μM dNTPs, 1× PCR buffer [Boehringer Mannheim], 100 ng of each primer, and 2 U of Taq polymerase [Boehringer Mannheim]). From the first PCR amplification, 3 μl of the first PCR product was used as template for the second (seminested) PCR reaction (under the same conditions) using the “Circle” primer and the DC-Dβ1 primer.

Quantitative Analysis of Endpoint Dilutions.

Second round PCR products were visualized with ethidium bromide on 1.25% agarose gels and digitally photographed. Individual amplifications were scored as positive or negative by two observers. The highest dilution returning a positive amplification was taken as the endpoint for each dilution series. Dilution series with more than two “skipped” wells (i.e, a failed amplification followed by a successful amplification at higher dilution) were omitted from the analysis. The abundance of DCs was estimated by the Reed-Muench method 20,21. This method uses information from replicate dilution series to estimate an endpoint (measured in terms of nanograms of input DNA) in which 50% of samples were positive for DCs (the 50% DC endpoint). The DC frequency (DCF) was arbitrarily defined as the reciprocal of the 50% DC endpoint × 100. Alternatively, the seminested PCR data were analyzed by a maximum likelihood estimated method of dilution endpoint with a parametric method 22. Unlike the Reed-Muench method, this method returns an estimate of goodness of fit of the data to the estimated endpoint. Endpoints estimated by the two methods were highly correlated (r 2 = 0.929), and the choice of method did not alter the conclusions drawn from the data. The degree of inter- and intraassay variation was assessed by performing two independent experiments on two different samples from the same individuals (m = 3) and ranged on the order of two- to threefold (data not shown).


Méthodes

RAG and HMGB1 protein purification

Truncated and full-length forms of RAG1 (residues 384–1040 and 1–1040, respectively) and RAG2 (residues 1–387 and 1–517, respectively) containing an amino-terminal maltose binding protein fusion partner (cMR1, FLMR1, cMR2, and FLMR2, respectively) were coexpressed in 293 cells and purified by amylose affinity chromatography according to published procedures [30]. Full-length, truncated, or mutant forms of amino-terminal polyhistidine-tagged HMGB1 were expressed in E. coli and purified as described elsewhere [26].

DNA substrates

Oligonucleotide substrates containing a 12-RSS or 23-RSS cRSS labelled at the 5' end of the top strand were prepared as described elsewhere [24, 30]. A substrate containing the bps6197 sequence was similarly prepared from the oligonucleotide 5'-TCCCCGAAAAGTGCCACCTGACG TCTAAGAAACC ATTATTATCATGACATTAACC TATAAA-3' and its complement (positions equivalent to the 23-RSS heptamer and nonamer motifs are underlined). Derivatives of this substrate containing mutations at positions indicated in the text were also prepared. Unlabeled DNA substrates containing consensus 12-RSS, 23-RSS, Hox11 or non-specific DNA sequences (DAR81/82) were prepared from oligonucleotides described previously [11, 24].

The plasmid V(D)J recombination substrates pGG49, its derivatives containing Ttg-1 or Hox11 cRSS sequences, and pJH299 have been described elsewhere [4, 10]. Derivatives of pGG49 lacking the 12-RSS or 23-RSS were generated by Sal moi ou BamH I digestion, respectively. Variants of pGG49 and pJH299 containing the wild-type or mutant bps6197 sequences discussed in the text were generated according to procedures described in Additional File 3: Supplementary Materials and Methods. Long DNA fragments (

650 bp) radiolabeled at the 5' end of the top strand containing the RSS, cRSS, and/or wild-type or mutant bps6197 sequences present in pGG49 and its derivatives were generated by PCR using radiolabeled primer 6000F (5'-TATTGTCCTCATGAGCGGATAC-3') and unlabeled primer 6624R (5'-GAACGGTGGTATATCCAGTG-3'). PCR samples (100 μl final volume) containing plasmid template DNA (70 ng) and primers (20 pmol each) were subjected to initial denaturation at 95°C for 4 min, followed by 30 cycles of amplification (95°C for 45 sec, 56°C for 30 sec, and 72°C for 60 sec) and a final extension (72°C for 4 min). PCR products were isolated using a QIAquick PCR purification kit (Qiagen), eluted in 50 μl buffer EB (10 mM Tris, pH 8.0), fractionated on a vertical agarose gel (1.4%) at 150V for 1.5 h, and gel-isolated DNA purified using a QIAquick Gel Extraction Kit (Qiagen).

In vitro RAG cleavage and binding assays

RAG-mediated cleavage of oligonucleotide substrates, PCR-generated long DNA fragments, or plasmid DNA was analyzed using an in vitro cleavage assay described previously [24]. Unless otherwise noted, basic in vitro cleavage reactions (10 μL) contained cMR1/cMR2 (


Voir la vidéo: VDJ recombination overview (Août 2022).